Annotated Borrelia burgdorferi B31 Plasmid

Annotated Borrelia burgdorferi B31 Plasmid Nucleotide Sequences

Fraser et al. (1997) and Casjens et al. (2000)

Compiled by Sherwood Casjens, Daniel Haft, Jeremy Peterson, Brian Stevenson and Claire Fraser
Last modified on Feb. 3, 2000.

This document is also available as Macintosh Microsoft WORD 5.1 and OFFICE ’98 (WORD’98) document from Sherwood Casjens.

ORGANIZATION OF THIS DOCUMENT (read me first)

The B. burgdorferi B31 chromosome and plasmid sequences are available at the TIGR Borrelia web site or from GENBANK. The accession numbers from GENBANK and gene name prefixes are as follows (as reported in Fraser et al. (1997) and Casjens et al. (2000):

Replicon	Accession #	gene name prefix

Chromosome	AE000788	BB0 (BBzero)
cp9	AE000791	BBC
cp26	AE000792	BBB
cp32-1	AE001575	BBP
cp32-3	AE001576	BBS
cp32-4	AE001577	BBR
cp32-6	AE001578	BBM
cp32-7	AE001579	BBO (BB"oh")
cp32-8	AE001580	BBL
cp32-9	AE001581	BBN
lp5	AE001583	BBT
lp17	AE000793	BBD
lp21	AE001582	BBU
lp25	AE000785	BBE
lp28-1	AE000794	BBF
lp28-2	AE000786	BBG
lp28-3	AE000784	BBH
lp28-4	AE000789	BBI
lp36	AE000788	BBK
lp38	AE000787	BBJ
lp54	AE000790	BBA
lp56	AE001584	BBQ

B31 Plasmid Open Reading Frame Summary

167 pseudogenes (+ about 10 others that have marginal similarity to "intact" genes)

62 "questionable" genes (29 in-frame fragments of larger pseudogenes; 33 ²300 bp genes inside a larger pseudogene in another frame and short genes that were not called in paralogous sequence elsewhere on the plasmids).

39 convincing similarity hits to genes of known function outside of Borrelia among plasmid genes

16 convincing similarity hits to genes of unknown function outside of Borrelia among plasmid genes

197 genes (which are not "questionable") have no paralog (63 of these are >300 bp and 134 are ²300 bp)

7 gene-like entities that we defined as pseudogenes have translation start codons that could possibly lead to expression of lipoproteins that are truncated relative to their paralogs

17 paralogous gene families are heterogeneous in that at least 1 potential LP and at least one non-LP is found in the family

These plasmids are: cp9, cp26, all seven of the cp32s, lp28-2, lp54 and the cp32-like portion of lp56

498 gene-like entities on the "well behaved" plasmids on which apparent protein-encoding genes occupy >70% of the DNA.

9 "questionable" genes (all are ²300 bp genes inside a larger pseudogene in another frame or short genes that were not called in paralogous sequence elsewhere on the plasmids).

23 convincing matches to genes of known function outside of Borrelia among plasmid genes (which are not "questionable")

13 convincing matches to genes of unknown function outside of Borrelia among plasmid genes (which are not "questionable")

These plasmids are: lp5, lp17, lp21, lp25, lp28-1, lp28-3, lp28-4, lp36, lp38, lp56 and the non-cp32-like portion of lp56

400 gene-like entities on the "bad" plasmids on which apparent protein-encoding genes occupy <75% of the DNA.

53 "questionable" genes (29 in-frame fragments of larger pseudogenes; 24 ²300 bp genes inside a larger pseudogene in another frame and short genes that were not called in paralogous sequence elsewhere on the plasmids).

16 convincing matches to genes of known function outside of Borrelia among plasmid genes (which are not "questionable")

3 convincing matches to genes of unknown function outside of Borrelia among plasmid genes (which are not "questionable")

Part I

Note that these definitions are NOT necessarily absolutely identical to those used in the other published gene lists and maps for B. burgdorferi or on the TIGR WEB site. In particular we have an expanded definition of "pseudogene" that includes truncated members of paralogous gene families.

Putative genes and gene names column lists all the putative "gene-like entities" - genes and pseudogenes - currently recognized in the twenty-one B. burgdorferi B31 plasmids. We tentatively interpret those genes not indicated to be pseudogenes to be intact and potentially functional, but since the functionality of most Borrelia genes is unknown this may not be true. The gene and plasmid names used here are those used in Fraser et al. (1997) and Casjens et al. (2000). Of course any given putative pseudo-, questionable, short, fragmented or frameshifted genes could in principle have an important function, but it seems likely that a substantial fraction of them are not functional.

† Daggers mark computer-recognized ORFs that are an in-frame and part of a larger pseudogene entity. To avoid counting the entity twice, these were ignored when compiling gene and pseudogene numbers in Casjens et al. (2000).

Coordinates - these columns list the positions of the 5’ and 3’ ends of the gene or pseudogene on the sequence of the relevant plasmid.

Database hit outside Borrelia indicates all similarities to non-Borrelia sequences in the extant database as of January 1999. The criteria for inclusion in the list are those of the TIGR protocol, which uses BLAST (Altschul et al., 1997), and alignments can be found on the TIGR Borrelia WEB page. A search using EMOTIF (Nevill-Manning et al., 1998) did not find any additional convincing B31 plasmid gene similarities to previously known genes.

Common name column gives gene names previously used in the literature. If it was previously named in a strain other than B31, the Borrelia strain is given in parentheses. In addition, we and others have suggested more specific, clarifying common names for genes currently under study in the following paralogous families: mlp [family 113], bdr [80], rev [63] and erp [162/163/164] genes.

Paralog family column indicates the family of paralogous genes (homologs within B. burgdorferi B31) to which individual genes belong. A complete list of genes and pseudogenes in each of these paralogous gene families can be found in PART II of this document.

N-terminal lipidation consensus refers to genes whose products are most likely to be lipoproteins.

Near-consensus N-terminal lipidation signal refers to genes whose products may be lipoproteins, but whose N-terminal amino acid sequences did not quite meet the arbitrary cutoff that we set for criteria for inclusion in the "probable lipoproteins" category.

See PART III of this document for a discussion of the strategies used to identifiy possible lipoprotein encoding genes.

Authentic frameshift genes contain one or a few simple frameshifts relative to their paralogs. It is unlikely that these are actually expressed by programmed frameshifting mechanisms, since they usually do not contain the expected translationally "slippery" sequences. The TIGR computer uses this term for damaged genes (hence it currently replaces "pseudogene" in some parts of the TIGR Borrelia web page). These considered to be pseudogenes in this analysis (Casjens et al., 2000).

Authentic point mutation gene has an in-frame stop codon relative to its paralogs. These are considered to be pseudogenes in this analysis.

Gene fragments or truncated genes are substantially shorter than other members of their paralogous families. Some of these could be expressed and have a function, although they are included in the pseudogene category for ease of discussion in this analysis and to point out that they are truncated.

Pseudogenes are regions of DNA that are similar in sequence to a paralogous Borrelia gene or to a gene from another organism, but which are obviously truncated and/or do not have full open reading frames relative to those homologs. These mostly appear to be mutationally damaged genes - they include "authentic frameshift", "authentic point mutation", fused and truncated genes. These pseudogenes often contain multiple frameshifts, deletions, insertions and inversions (see Casjens et al., 2000).

Exceptions to this definition of a pseudogene are the 15 silent vlsE cassettes on lp28-1; these are not damaged are apparently "designed" to be a reservoir of antigenic variation for the vlsE protein. They are pseudogenes in that they are incomplete relative to the expressed vlsE gene and are probably not expressed themselves.

Of course the gene fragments whose reading frames are intact, that we include in this category for ease of discussion, could in fact be expressed and if so could perform a function. Nonetheless such fragments are very unusual in prokaryotes, and given the other evidence for many rearrangements in the B31 plasmids (Casjens et al., 2000) it seems likely that many, if not all of such fragments, may no longer have a biological function.

See PART IV of this document for a complete list of pseudogenes and the reasons why each is so classified.

"Questionable genes" were called by TIGR’s standard gene recognition protocol, but there is reason to suspect they may be spurious calls. For example, "computer-called genes" that are inside another gene or pseudogene and small genes that were not called in paralogous sequence elsewhere in the Borrelia sequence. Those marked with daggers (†) are inside of larger pseudogenes, but which were nonetheless called as genes by the TIGR protocol.

See PART IV of this document for a complete list of questionable genes and the reasons why each is so classified.

Short genes are <300 bp in length but ARE NOT in the "questionable" or "pseudogene" categories. The Borrelia plasmids have an inordinately large fraction of called genes that are <300 bp in length. These are often not tightly packed and fall into regions that contain no larger genes. Of course any given putative short gene could in principle be functional, but it seems likely that a substantial fraction of them are not functional

Putative functions were deduced in most cases from homologies to genes of known function.

WE EMPHASIZE ONE MORE TIME! Any given putative pseudo-, questionable, short, fragmented or frameshifted gene (as we have defined them) could in principle be functional. But it seems likely that a substantial fraction of them are not functional. We use the above pseudogene definitions only as terms to describe relevant features of the B31 plasmid genes, not to imply functionality in any specific cases.

Putative Gene	5’end	3’end	Database hit outside Borrelia {organism of best database hit}	Common Name	Paralog Family	Comments/References
cp9						A homolog of cp9, called cp8.3 from B. garinii strain Ip21 was completely sequenced by (Dunn et al., 1994)
BBC01	163	1269			57
BBC02	1282	1836			50
BBC03	1892	2449			49
BBC04	2700	2593				short gene
BBC05	2804	3709			161
BBC06	4377	3856		eppA	95	exported protein (Champion et al., 1994)
BBC07	4788	4507				short gene
BBC08	5534	5977			55
(BBC09)						Does not exist; erroneously present in original gene list and map in figure 2 of Fraser et al. (1997)
BBC10	6808	6284			63	N-terminal lipidation consensus
BBC11	6974	7768			96
BBC12	9203	7914			165

cp26						Homolog of cp26 present in essentially all isolates (e.g., Tilly et al., 1997)
BBB01	16	321	conserved hypothetical protein {Escherichia coli}			weak similarity to acylphosphatase
BBB02	751	311
BBB03	2186	840	weak (Y-BLAST) similarity to phage N15 gene 29			The protein encoded by this gene has weak similarity to the putative "protelomerase" encoded by gene 29 of phage N15 ( Ravin et al., in preparation). Circumstantial evidence suggests this N15 protein is responsible for hairpoin end formation in the N15 prophage plasmid.
BBB04	3807	2479	PTS system, cellobiose-specific IIC component (celB) {Bacillus stearothermophilus}			possible chitobiose transporter (Fraser et al., 1997)
BBB05	4084	4428	PTS system, cellobiose-specific IIA component (celC) {Bacillus subtilis}			possible chitobiose transporter (Fraser et al., 1997)
BBB06	4440	4754	PTS system, cellobiose-specific IIB component (celA) {Bacillus subtilis}			possible chitobiose transporter (Fraser et al., 1997)
BBB07	4769	5863
BBB08	6517	5891				N-terminal lipidation consensus
BBB09	6677	7711				N-terminal lipidation consensus
BBB10	7836	8762			62
BBB11	8781	9296			50
BBB12	9275	10033	plasmid partition protein {Bacillus subtilis}		32	putative plasmid partition function
BBB13	10104	10649			49
BBB14	11417	10923				N-terminal lipidation consensus
BBB15	11636	11737				short gene
BBB16	12014	13603	oligopeptide ABC transporter, periplasmic oligopeptide-binding protein {Escherichia coli}	oppAIV	37	N-terminal lipidation consensus, not surface exposed, and not essential in culture (Bono et al., 1998)
BBB17	15107	13896	IMP dehydrogenase {Haemophilus influenzae}	guaA		IMP dehydrogenase (Margolis et al., 1994b; Zhou et al., 1997)
BBB18	16718	15135	GMP synthase {Haemophilus influenzae}	guaB		putative GMP synthase Margolis et al., 1994b) erroneous duplication in cp26 between BBB18 and BBB19 corrected in current gene list; affected originally released gene coordinates to right of BB18
BBB19	16903	17532		ospC		surface localized (Wilske et al., 1993), N-terminal lipidation consensus (Fuchs et al., 1992; Jauris-Heipke et al., 1993; Jauris-Heipke et al., 1995; Marconi et al., 1993c; Margolis et al., 1994a; Margolis et al., 1994b; Masuzawa et al., 1997; Stevenson and Barthold, 1994; Stevenson et al., 1994; Tilly et al., 1997; Wang et al., 1999; Wilske et al., 1996a; Wilske et al., 1996b); transcription start site (Marconi et al., 1993b); temperature regulation (Schwan et al., 1995; Stevenson et al., 1995)
BBB20	17733	17626				short gene
BBB21	17750	17842				short gene
BBB22	19321	17969	conserved hypothetical protein MJ0326 {Methanococcus jannaschii}		94	12 putative membrane spanning regions; homologs in E. coli
BBB23	20822	19434	conserved hypothetical protein MJ0326 {Methanococcus jannaschii}		94	12 putative membrane spanning regions; homologs in E. coli
BBB24	21364	20861				near-consensus N-terminal lipidation signal
BBB25	21851	21342				N-terminal lipidation consensus
BBB26	21898	22590
BBB27	23154	22606				N-terminal lipidation consensus
BBB28	23255	24496
BBB29	24825	26450	PTS system, maltose and glucose-specific IIABC component (malX) {Escherichia coli}		16	putative sugar transport

cp32-1
BBP01	66	1286			146
BBP02	1306	1995			147
BBP03	2011	2565			148
BBP04	2575	3336			148
BBP05	3369	3938			148
BBP06	3948	4919			149	(Casjens et al., 1997)
BBP07	4936	5394			150
BBP08	5379	5777			107
BBP09	5768	6154			108
BBP10	6154	6717			151
BBP11	6701	7810			152
BBP12	7828	8253			153
BBP13	8272	8724			154
BBP14	8724	8957			155	short gene
BBP15	8968	10239			156
BBP16	10265	10945			157
BBP17	10952	11899			159
BBP18	11920	12462			160
BBP19	12495	12824			139
BBP20	12824	13696			140
BBP21	13709	14311			141
BBP22	14324	15136			142
BBP23	15215	15415		orfA-1; blyA-1	109	putative hemolysin; short gene; sequenced for homologous plasmids in strain 297 by Porcella et al. (1996)
BBP24	15422	15766		orfB; blyB-1	111	putative hemolysin; sequenced for homologous plasmids in strain 297 by Porcella et al. (1996)
BBP25	15759	16091		orfC	112	(Gilmore and Mbow, 1998); sequenced in homologous plasmids of strain 297 by Porcella et al. (1996)
BBP26	16081	16437		orfD	143	(Gilmore and Mbow, 1998); sequenced in homologous plasmids of strain 297 by Porcella et al. (1996); near-consensus N-terminal lipidation signal but strain 297 homolog was not ipidated in E. coli.
BBP27	17060	16581		rev-1	63	N-terminal lipidation consensus (Gilmore and Mbow, 1998); sequenced in homologous plasmids of strain 297 by Porcella et al.(1996)
BBP28	17232	17675		mlpA	113	N-terminal lipidation consensus (Gilmore and Mbow, 1998); sequenced in several homologous plasmids of strain 297 by Porcella et al. (1996); lipidated in E. coli (Porcella et al., 1996); paralog lipidated in B. afzelii Theisen (1996)
BBP29	18728	17718		orf4-1	161	(Gilmore and Mbow, 1998)
BBP30	19114	20211		orf1-1	57	(Zuckert and Meyer, 1996)
BBP31	20224	20787		orf2-1	50	(Zuckert and Meyer, 1996)
BBP32	20766	21503	plasmid partition protein {Bacillus subtilis}	orfC-1	32	putative plasmid partition function (Zuckert and Meyer, 1996)
BBP33	21510	22115		orf3-1	49	(Zuckert and Meyer, 1996)
BBP34	22131	22760		bdrA	80	contains 4.7 repeats of a 54 bp sequence; all "bdr" genes contain direct, tandem repeats (Casjens et al., 1999; Zuckert and Meyer, 1996)
BBP35	23231	24553		orf8/7-1	165	(Casjens et al., 1997; Zuckert and Meyer, 1996)
BBP36	24609	25031		orf10-1	144	(Casjens et al., 1997)
BBP37	25816	25043		orf6-1	96	(Casjens et al., 1997)
BBP38	26235	26765		erpA	162	surface exposed (Lam et al., 1994); N-terminal lipidation consensus (Stevenson et al., 1996); lipidated in E. coli (Akins et al., 1995b; Wallich et al., 1995); erp-like genes have been sequenced from several other strains (Akins et al., 1999; Lam et al., 1994; Marconi et al., 1996b; Stevenson et al., 1997; Suk et al., 1995)
BBP39	26796	27929		erpB	163	N-terminal lipidation consensus (Stevenson et al., 1996)
BBP40	28074	28652			114
BBP41	28835	29398			115
BBP42	29398	30747	conserved hypothetical protein Orf26 of phage fO1205 {Streptococcus thermophilus}		145	(Amouriaux et al., 1993; Casjens et al., 1997); phage fO1205 Orf26 homology; Orf26 is a possible phage structural protein

cp32-3
BBS01	66	1286			146
BBS02	1306	1995			147
BBS03	2011	2565			148
BBS04	2575	3336			148
BBS05	3369	3938			148
BBS06	3963	4919			149	(Casjens et al., 1997)
BBS07	4936	5394			150
BBS08	5379	5777			107
BBS09	5768	6154			108
BBS10	6154	6717			151
BBS11	6701	7810			152
BBS12	7828	8253			153
BBS13	8272	8724			154
BBS14	8724	8957			155	short gene
BBS15	8968	10239			156
BBS16	10265	10945			157
BBS17	10952	11899			159
BBS18	11920	12462			160
BBS19	12495	12824			139
BBS20	12824	13696			140
BBS21	13709	14311			141
BBS22	14324	15133			142
BBS23	15212	15412		blyA-3	109	putative hemolysin; short gene
BBS24	15419	15763		blyB-3	111	putative hemolysin;
BBS25	15756	16088			112
BBS26	16078	16434			143	near-consensus N-terminal lipidation signal
BBS27	16586	16900
BBS28	16915	17046				short gene
BBS29	17068	17694		bdrF	80	contains 3.6 repeats of a 33 bp sequence
BBS30	17803	18246		mlpC	113	N-terminal lipidation consensus
BBS31	19159	18290		orf4-3	161	(Zuckert and Meyer, 1996)
BBS32	19198	19392	conserved hypothetical protein {Chlorella vulgaris}(similarity poor)			questionable gene; gene not called in paralogous sequence on other cp32s
BBS33	19605	20702		orf1-3	57	(Zuckert and Meyer, 1996)
BBS34	20715	21278			50
BBS35	21257	21994	plasmid partition protein {Bacillus subtilis}	orfC-3	32	putative plasmid partition function; (Stevenson et al., 1998b)
BBS36	22038	22577		orf3-3	49	(Stevenson et al., 1998b)
BBS37	22593	23180		bdrE	80	contains 4.1 repeats of a 54 bp sequence
BBS38	23649	25013		orf8/7-3	165	(Casjens et al., 1997)
BBS39	25069	25491		orf10-3	144	(Casjens et al., 1997)
BBS40	26276	25503		orf6-3	96	(Casjens et al., 1997)
BBS41	26708	27295		erpG; pG	164	N-terminal lipidation consensus; (Stevenson et al., 1996; Wallich et al., 1995)
BBS42	27410	27916		bapA	95	(Stevenson et al., 1996; Wallich et al., 1995)
BBS43	28067	28246				short gene
BBS44	28236	28871			115
BBS45	28871	30220	conserved hypothetical protein Orf26 of phage f01205 {Streptococcus thermophilus}		145	(Amouriaux et al., 1993; Casjens et al., 1997); phage f01205 Orf26 homology; Orf26 is a possible phage structural protein

cp32-4
BBR01	66	1286			146
BBR02	1306	1998			147	pseudogene; authentic frameshift
BBR03	2013	2573			148
BBR04	2580	3344			148
BBR05	3340	3948		orfI	148	(Casjens et al., 1997)
BBR06	3958	4929		orfII	149	(Casjens et al., 1997)
BBR07	4952	5404		orfIII	150	(Casjens et al., 1997)
BBR08	5389	5787		orfIV	107	(Casjens et al., 1997)
BBR09	5778	6164		orfV	108	(Casjens et al., 1997)
BBR10	6164	6727			151
BBR11	6711	7820			152
BBR12	7838	8263			153
BBR13	8282	8734			154
BBR14	8734	8967			155	short gene
BBR15	8978	10270			156
BBR16	10296	10889			157
BBR17	10896	11843			159
BBR18	11864	12415			160
BBR19	12448	12777			139
BBR20	12777	13649			140
BBR21	13662	14264			141
BBR22	14277	15089			142
BBR23	15167	15367		blyA-4	109	putative hemolysin; short gene
BBR24	15374	15718		blyB-4	111	putative hemolysin
BBR25	15711	16043			112
BBR26	16033	16389			143	near-consensus N-terminal lipidation signal
BBR27	16467	16994		bdrH	80	sequenced in homologous plasmids of strain 297 by Porcella et al. (1996) and in B. afzelii by Theisen (1996)
BBR28	17103	17522		mlpD	113	N-terminal lipidation consensus
BBR29	18664	17576			161
BBR30	18829	18737				questionable gene; gene not called in paralogous sequence on other cp32s
BBR31	18960	20054			57
BBR32	20067	20630			50
BBR33	20609	21361	plasmid partition protein {Bacillus subtilis}	orfC-4	32	putative plasmid partition function (Stevenson et al., 1998b)
BBR34	21415	21957		orf3-4	49	(Stevenson et al., 1998b)
BBR35	21974	22249		bdrG	80	authentic point mutation; has an in-frame stop codon
BBR36	22831	24153			165
BBR37	24210	24632		orf10-4	144	(Casjens et al., 1997)
BBR38	25435	24644		orf6-4	96	(Casjens et al., 1997); sequence from strain N40 - assession # AF011453
BBR39	25636	25538				questionable gene; gene not called in paralogous sequence on other cp32s
BBR40	25865	25966		erpH	162	pseudogene; severely truncated relative to other erps; N-terminal lipidation consensus (Stevenson et al., 1996)
BBR41	26077	26817			161/ 162	pseudogene; this is a "fusion" gene - a family [161] gene is fused to an [162] erp gene
BBR42	26853	27524		erpY	164	N-terminal lipidation consensus
BBR43	27634	28200			114
BBR44	28384	28947			115
BBR45	28947	30296	conserved hypothetical protein Orf26 of phage fO1205 {Streptococcus thermophilus}		145	homolog of phage Streptococcus thermophilus fO1205 gene orf26 that is likely to be phage structural protein; (Amouriaux et al., 1993; Casjens et al., 1997)

cp32-6
BBM01	66	1286			146
BBM02	1306	1995			147
BBM03	2010	2570			148
BBM04	2577	3341			148
BBM05	3337	3945			148
BBM06	3955	4926			149
BBM07	4949	5401			150
BBM08	5386	5784			107
BBM09	5775	6161			108
BBM10	6161	6727			151
BBM11	6711	7820			152
BBM12	7838	8263			153
BBM13	8282	8734			154
BBM14	8734	8967			155	short gene
BBM15	8978	10249			156
BBM16	10275	10955			157
BBM17	10962	11909			159
BBM18	11930	12481			160
BBM19	12514	12843			139
BBM20	12843	13715			140
BBM21	13728	14330			141
BBM22	14343	15152			142
BBM23	15231	15431		blyA-6	109	putative hemolysin; short gene
BBM24	15438	15782		blyB-6	111	putative hemolysin
BBM25	15775	16107			112
BBM26	16097	16453			143	near-consensus N-terminal lipidation signal
BBM27	17075	16596		rev-6	63	N-terminal lipidation consensus
BBM28	17247	17693		mlpF	113	N-terminal lipidation consensus
BBM29	18680	17736			161
BBM30	19069	20166			57
BBM31	20179	20742			50
BBM32	20721	21467	plasmid partition protein {Bacillus subtilis}	orfC-6	32	putative plasmid partition (Stevenson et al., 1998b)
BBM33	21520	22095		orf3-6	49	(Stevenson et al., 1998b)
BBM34	22102	22767		bdrK	80
BBM35	23241	24563			165
BBM36	24619	25041			144
BBM37	25820	25053			96	only [96] member with signal sequence
BBM38	26245	27012		erpK	164	N-terminal lipidation consensus; (Casjens et al., 1997)
BBM39	27745	27080
BBM40	27731	27850				questionable gene; gene not called in paralogous sequence on other cp32s
BBM41	27923	28486			115
BBM42	28486	29835	conserved hypothetical protein Orf26 of phage fO1205 {Streptococcus thermophilus}		145	phage fO1205 Orf26 homology; Orf26 is a possible phage structural protein; (Amouriaux et al., 1993; Casjens et al., 1997)

cp32-7
BBO01	65	1285			146
BBO02	1305	1994			147
BBO03	2010	2564			148
BBO04	2574	3335			148
BBO05	3368	3937			148
BBO06	3962	4918			149
BBO07	4935	5393			150
BBO08	5378	5776			107
BBO09	5767	6153			108
BBO10	6153	6719			151
BBO11	6703	7812			152
BBO12	7830	8255			153
BBO13	8274	8726			154
BBO14	8726	8959			155	short gene
BBO15	8970	10301			156
BBO16	10317	10955			157
BBO17	10962	11900			159
BBO18	11904	12470			160
BBO19	12503	12832			139
BBO20	12832	13707			140
BBO21	13716	14318			141
BBO22	14331	15143			142
BBO23	15222	15422		blyA-7	109	putative hemolysin; short gene
BBO24	15429	15782		blyB-7	111	putative hemolysin
BBO25	15766	16098			112
BBO26	16088	16444			143	near-consensus N-terminal lipidation signal
BBO27	16522	17136		bdrN	80
BBO28	17245	17664		mlpG	113	N-terminal lipidation consensus
BBO29	18770	17715			161
BBO30	19117	20211			57
BBO31	20224	20787			50
BBO32	20766	21512	plasmid partition protein {Bacillus subtilis}	orfC-7	32	putative plasmid partition function (Stevenson et al., 1998b)
BBO33	21522	22073		orf3-7	49	(Stevenson et al., 1998b)
BBO34	22088	22657		bdrM	80
BBO35	22755	22630				questionable gene; gene not called in paralogous sequence in other cp32s
BBO36	23093	24457			165
BBO37	24513	24935			144
BBO38	25720	24947			96
BBO39	26152	26838		erpL	164	N-terminal lipidation consensus (Casjens et al., 1997)
BBO40	26893	27981		erpM	163	N-terminal lipidation consensus (Casjens et al., 1997)
BBO41	28117	28007			116	questionable gene; gene not called in paralogous sequence in other cp32s
BBO42	28134	28700			114
BBO43	28885	29448			115
BBO44	29448	30797	conserved hypothetical protein Orf26 of phage fO1205 {Streptococcus thermophilus}		145	(Amouriaux et al., 1993; Casjens et al., 1997); phage fO1205 Orf26 homology; Orf26 is a possible phage structural protein

cp32-8
BBL01	66	1286			146
BBL02	1306	1995			147
BBL03	2011	2565			148
BBL04	2575	3336			148
BBL05	3369	3938			148
BBL06	3948	4919			149
BBL07	4936	5394			150
BBL08	5379	5777			107
BBL09	5768	6154			108
BBL10	6154	6717			151
BBL11	6701	7810			152
BBL12	7828	8253			153
BBL13	8272	8724			154
BBL14	8724	8957			155	short gene
BBL15	8968	10239			156
BBL16	10265	10945			157
BBL17	10952	11899			159
BBL18	11920	12462			160
BBL19	12495	12824			139
BBL20	12824	13696			140
BBL21	13709	14311			141
BBL22	14324	15136			142
BBL23	15215	15415		blyA-8	109	putative hemolysin; short gene
BBL24	15422	15766		blyB-8	111	putative hemolysin
BBL25	15759	16091			112
BBL26	16081	16437			143	near-consensus N-terminal lipidation signal
BBL27	16515	17096		bdrO	80
BBL28	17205	17648		mlpH	113	N-terminal lipidation consensus
BBL29	18761	17691			161
BBL30	19091	20185			57
BBL31	20198	20761			50
BBL32	20740	21477	plasmid partition protein {Bacillus subtilis}		32	putative plasmid partition function
BBL33	21467	21556				short gene
BBL34	21540	22097			49
BBL35	22113	22688		bdrP	80
BBL36	23306	24688			165
BBL37	24744	25166			144
BBL38	25951	25178			96
BBL39	26370	26900		erpN	162	N-terminal lipidation consensus
BBL40	26931	28064		erpO	163	N-terminal lipidation consensus
BBL41	28209	28787			114
BBL42	28970	29533			115
BBL43	29533	30882	conserved hypothetical protein Orf26 of phage fO1205 {Streptococcus thermophilus}		145	phage fO1205 Orf26 homology; Orf26 is a possible phage structural protein

cp32-9
BBN01	66	1289			146
BBN02	1309	1998			147
BBN03	2013	2576			148
BBN04	2583	3347			148
BBN05	3343	3950			148	pseudogene; authentic frameshift
BBN06	3960	4935			149	pseudogene; authentic frameshift
BBN07	4958	5410			150
BBN08	5395	5793			107
BBN09	5784	6170			108
BBN10	6170	6733			151
BBN11	6717	7802			152
BBN12	7845	8270			153
BBN13	8289	8742			154	pseudogene; authentic frameshift
BBN14	8742	8975			155	short gene
BBN15	8986	10257			156
BBN16	10283	11034			157	pseudogene; authentic frameshift
BBN17	11041	11988			159
BBN18	12009	12560			160	pseudogene; authentic frameshift
BBN19	12593	12922			139
BBN20	12922	13794			140
BBN21	13807	14410			141	pseudogene; authentic frameshift
BBN22	14423	15230		orfX-9	142	pseudogene; authentic frameshift (Guina and Oliver, 1997)
BBN23	15312	15512		blyA-9	109	pore-forming hemolysin; short gene (Guina and Oliver, 1997)
BBN24	15519	15863		blyB-9	111	hemolysin accessory protein (Guina and Oliver, 1997)
BBN25	15856	16188		orfC-9	112	(Guina and Oliver, 1997)
BBN26	16178	16534		orfD-9	143	(Guina and Oliver, 1997); near-consensus N-terminal lipidation signal
BBN27	16612	17193		bdrR	80	(Guina and Oliver, 1997)
BBN28	17302	17727		mlpI	113	N-terminal lipidation consensus
BBN29	18784	17776			161	pseudogene; authentic frameshift
BBN30	19164	20261			57
BBN31	20275	20838			50
BBN32	20817	21569	plasmid partition protein {Bacillus subtilis}		32	putative plasmid partition function
BBN33	21614	22171			49
BBN34	22184	22720		bdrQ	80
BBN35	23194	24516			165
BBN36	24572	24994			144
BBN37	25779	25006			96	pseudogene; authentic frameshift
BBN38	26198	26767		erpP	162	N-terminal lipidation consensus
BBN39	26798	27826		erpQ	163	N-terminal lipidation consensus
BBN40	27991	27884			116	questionable gene; gene not called in paralogous sequence on other cp32s
BBN41	27984	28541			114
BBN42	28736	29299			115
BBN43	29299	30648	conserved hypothetical protein Orf26 of phage fO1205 {Streptococcus thermophilus}		145	phage fO1205 Orf26 homology; Orf26 is a possible phage structural protein

lp5
BBT01	195	635			57	pseudogene
BBT02	744	1094			57	pseudogene
BBT03	1208	1573			84	(pseudogene; also [57] related?)
BBT04	2148	3251			57
BBT05	3200	3350			57	pseudogene
BBT06	3340	4329	conserved hypothetical protein ywlC {Bacillus subtilis}		137	family of genes that includes yeast SUA gene
BBT07	4388	4816			52	pseudogene

lp17						lp17 from B31 was independently sequenced by Barbour et al (1996) Hinnebusch et al. (1990) determined the sequences of the two telomeres - those sequences contain 29 bp and 78 bp that are not present in the TIGR sequence
BBD001	214	405		orfA	166	short gene; N-terminal lipidation consensus
BBD01	332	802		orfB	76
BBD02	873	1019			57/77	pseudogene
BBD03	1117	1309			57	pseudogene
BBD04	1412	1765		orfC	57	pseudogene; different translation start called by Barbour et al. (1996)
BBD05	2389	2541		orfD	84	(pseudogene [57]?)
BBD05.1	3018	3604			57	pseudogene
† BBD06	3143	3604		orfE	57	in-frame and inside pseudogene BBD05.1; questionable gene
BBD07	4373	4260			82	short gene
BBD08	4707	4802	transposase-like protein {Anabena}		82	pseudogene
BBD09	5058	5738		orfF
BBD10	6454	5879		orfG		N-terminal lipidation consensus
BBD11	6681	7631		orfH		sequence difference caused Barbour et al. (1996) orfH to end at ~7556
BBD12	7752	7624				short gene
BBD13	7787	8110		orfI
BBD14	8269	9378		orfJ	62
BBD15	10015	9596		orfK	85	different start called by Barbour et al. (1996); N-terminal lipidation consensus
BBD15.01	10000	9940			175	pseudogene
BBD15.1	10152	10326	transposase-like protein {Anabena}		82	pseudogene
BBD16	10520	10428				short gene
BBD17	10591	10683				short gene
BBD18	11648	10989		orfL
BBD19	12057	12167				short gene
BBD20	12250	12975	transposase-like protein {Anabena}		82	pseudogene
21 bp repeat	13154	13329				8.3 tandem, direct repeats of TAATTAATATGTGATATAAAA; not in a gene
BBD21	13341	14078	plasmid partition protein {Bacillus subtilis}	orfM	32	putative plasmid partition function
BBD22	14072	14338		orfN		short gene
BBD23	14781	15725	transposase-like protein {Anabena}		82	pseudogene
BBD24	16121	15894		orfO		N-terminal lipidation consensus; short gene
BBD25	16212	16367				short gene

lp21
BBU01	184	615			57	pseudogene
BBU02	746	1111			84	(pseudogene [57]?)
BBU03	1357	1241			172	short
BBU04	1486	2625			57
BBU05	2868	3653	plasmid partition protein {Bacillus subtilis}		32	putative plasmid partition function
63 bp repeat (not a gene)	3618	14636				tandem array of about 176 repeats of 63 bp sequence; not in ORF, has stop codons in all 6 frames (Casjens et al., 2000)
BBU06	14633	15232			49
BBU07	15349	15810			57	pseudogene
BBU08	15791	16081			137	pseudogene; short
BBU09	16548	16231			55	pseudogene?
BBU10	16603	16797			57	pseudogene; short
BBU11	16886	17875	protein Y02L_MYCTU {Mycobacterium tuberculosis}		137	family of genes that includes B. subtilis ywlC and yeast SUA genes
BBU12	17918	18362			52	pseudogene; authentic frameshift

lp25
BBE01	255	157				short gene
BBE02	4156	326			1
BBE03	4613	4422			98	short gene
BBE04	4719	4856			54	pseudogene; near-consensus N-terminal lipidation signal
BBE04.1	5377	5734			44	pseudogene
† BBE05	5377	5526			44	inside and in-frame with BBE04
BBE06	5757	5903				N-terminal lipidation consensus; short gene
BBE07	6401	6185	psf-I protein {Escherichia coli}		26	pseudogene
BBE08	6701	6558				N-terminal lipidation consensus; short gene
BBE09	6898	7758			44	N-terminal lipidation consensus
BBE10	7972	7877				short gene
BBE11	8446	8315				short gene
BBE12	8646	8524				short gene
BBE13	8863	8955				short gene
BBE14	9163	9375				short gene
BBE15	9490	9356				short gene
BBE16	10187	9570			99	near-consensus N-terminal lipidation signal (but short signal sequence?)
BBE17	10709	10203
BBE18	12079	11501			49
BBE19	12854	12099	plasmid partition protein {Bacillus subtilis}		32	putative plasmid partition function
BBE20	13393	12833			50
BBE21	14530	13406			57
BBE21.1	14767	14893	transposase-like protein {Anabena}		82	pseudogene
BBE22	15578	15045	pyrazinamidase/nicotinamidase (pncA) {Mycobacterium tuberculosis}			putative pyrazinamidase/nicotinamidase (pncA)
BBE23	15973	16155				short gene
BBE23.1	16459	16540			57	pseudogene
BBE23.2	16540	16721	plasmid partition protein {Bacillus subtilis}		32	pseudogene
BBE24	16740	17300			49	pseudogene
BBE24.1	17902	18303			49	pseudogene
BBE25	18606	18505				short gene
BBE26	18586	18711				short gene; near-consensus N-terminal lipidation signal
BBE27	19055	19195				short gene
BBE28	19489	19340				near N-terminal lipidation consensus; short gene
BBE29	19697	20883	adenine specific DNA methyltransferase {Helicobacter pylori}		167	pseudogene; adenine specific DNA methyltransferase
BBE29.1	21110	21476			102	pseudogene
BBE30	21558	21701			49	pseudogene
BBE31	22677	21949			60	N-terminal lipidation consensus
BBE32	23723	23418			57	pseudogene
BBE33	24100	23850			169	pseudogene; authentic frameshift

lp28-1						Zhang et al. (1997) determined the sequence of the right telomere of lp28-1.
BBF001	1	163			88	pseudogene; near-consensus N-terminal lipidation signal
BBF001.1	200	380			80	pseudogene
BBF01	467	1462		erpT (N40)	163	small patch of similarity to erp genes of family 163; near-consensus N-terminal lipidation signal and affinity to lipoprotein families [60] and [163]; (Fikrig et al., 1999)
BBF02	1720	2073	orf105 {Plasmodium falciparum} fairly poor match		88	pseudogene
BBF03	2619	2101		bdrS	80	pseudogene - N-terminal truncation; contains about 3 repeats each of 2 different 33 bp sequences
BBF04	2658	2804			57/77	pseudogene in [57]
BBF05	2777	3073			57	pseudogene in [57]
BBF06	3201	3377			57	pseudogene in [57] (actually a "fusion" gene)
BBF07	3529	3413			100	short gene
BBF08	3849	3685			72	pseudogene; paralog of fragment of BBK43
BBF09	4027	4179			71	pseudogene; paralog of C-term of BBK42
BBF10	4488	4982			70
BBF11	5435	5539				questionable gene; backwards inside BBF11.1
BBF11.1	5620	5412			32	pseudogene
BBF12	6540	5956			49	pseudogene (?) in [49] - patchy similarity to other [49] genes
BBF13	7381	6635	plasmid partition protein {Bacillus subtilis}		32	putative plasmid partition function
BBF14	7911	7357			50
BBF14.1	8197	8367			65	pseudogene
BBF16	8389	8571			64	pseudogene; paralog of N-term of K34
BBF17	8772	9026			68	pseudogene; paralog of N-term of K35
BBF18	9561	10049	transposase-like protein {Anabena}		82	pseudogene
† BBF19	10559	10036	transposase-like protein {Anabena}		82	questionable gene; BBF18 and F19 are almost certainly inverted parts of one complex pseudogene
BBF19.1	10916	11200			175	pseudogene
BBF20	10991	10701			85	N-terminal lipidation consensus; pseudogene
BBF21	11550	11449			66	short gene
BBF22	12018	11794			44	pseudogene
BBF23	12992	12444			49
BBF24	13793	13032	plasmid partition protein {Bacillus subtilis}		32	putative plasmid partition function
BBF25	14329	13772			50
BBF26	15451	14354			57
BBF26.1	15663	16209			101	badly deleted pseudogene
† BBF27	15925	15758			101	questionable gene; in-frame and inside BBF26.1
† BBF28	16129	16001				questionable gene; out-of-frame (?) and inside BBF26.1
BBF29	16825	16457			49	pseudogene
BBF30	17415	17170				short gene
BBF31	17805	17394			50	pseudogene
BBF31.1	17920	18050			57	pseudogene
BBF32	26698	18430			170	15 tandem pseudogenes; N-terminal lipidation consensus; unexpressed reservoir of diversity for vlsE expression site; no frame disruptions (Zhang et al., 1997; Zhang and Norris, 1998a; Zhang and Norris, 1998b)
vlsE	27097	28170		vlsE	170	surface exposed; N-terminal lipidation consensus; this is the vlsE expression site; it is beyond the end of the TIGR lp28-1 sequence; there is a 100 bp gap (apparently unclonable sequence) between the TIGR and vlsE sequences (Zhang et al., 1997; Zhang and Norris, 1998a; Zhang and Norris, 1998b)

lp28-2
BBG01	116	1006			12	N-terminal lipidation consensus
BBG02	1047	1925	HP1353 gene {Helicobacter pylori}		102	N-terminal lipidation consensus; rather good similarity to HP1353 across the C-terminal 3/4 of the gene - HP1353 has an "FLSTC" sequence that is about 30 aa’s from the N-terminus, not a good lipidation consensus and not a particularly good signal sequence; HP1352 & HP1354 are putative adenine methylases!
BBG03	2104	2492			48	pseudogene; authentic frameshift
BBG04	2857	2753				short gene
BBG05	4056	2894	transposase-like protein {Anabena}		82	pseudogene; one authentic frameshift; BBG05 is the most intact member of this family which is homologous throughout its length to a putative transposase gene family originally found in Anabena, Saccharopolyspora, Salmonella and thermophilic bacterium PS3 (Bancroft and Wolk, 1989; Donadio and Staver, 1993; Gulig et al., 1992; Krause et al., 1991; Murai et al., 1995); BBG05 was first characterized by Barbour and Carter (1997)
BBG06	4208	5365			57
BBG07	5378	5947			50
BBG08	5911	6675	plasmid partition protein {Bacillus subtilis}		32	putative plasmid partition function
BBG09	6737	7285			49
BBG10	10779	7486			101	weak similarity to phage TM4 tail tape measure protein in a psi-BLAST search
BBG11	11015	10779				short gene
BBG12	11491	11066
BBG13	12355	11504
BBG14	12752	12312
BBG15	12681	13166
BBG16	13495	13160
BBG17	14341	13511
BBG18	14885	14379
BBG19	15431	14889			117
BBG20	16482	15460			103
BBG21	17684	16497
BBG22	18827	18033			86
BBG23	19619	18840			86
BBG24	22310	19623			104
BBG25	22659	22276			143	N-terminal lipidation consensus
BBG26	23033	22662
BBG27	23725	23036
BBG28	24108	23725
BBG29	24489	25952			62
BBG30	25962	26387
BBG31	26567	27082			50	pseudogene; N-terminus missing relative to paralogs
BBG32	27113	27937	replicative DNA helicase, putative {Bacillus subtilis}		46	putative DNA helicase
BBG33	28031	28828		bdrT	80	contains 3 repeats of 87 bp sequence and 4 repeats of a 33 bp sequence
BBG34	29618	28857			88

lp28-3
BBH01	273	464			166	N-terminal lipidation consensus; short gene
BBH02	391	855			76
BBH03	926	1072			57/77	pseudogene
BBH04	1045	1365			57	pseudogene
BBH05	1498	1677			57	pseudogene
BBH06	2970	2263				near-consensus N-terminal lipidation signal
BBH07	3514	3086			50	pseudogene
BBH08	3730	3593				short gene
BBH09	7728	3895			1
BBH09.1	8091	7810			95	pseudogene
BBH10	8203	8003				questionable gene (overlaps BBH09.1)
BBH10.1	8240	8310	transposase-like protein {Anabena}		82	pseudogene
BBH11	8796	8704				questionable gene; backwards inside BBH11.1
BBH11.1	8320	8850			1	pseudogene (in part)
BBH12	9455	9589				short gene
BBH13	10516	9851		bdrU	80	contains 5.6 repeats of a 54 bp sequence
BBH14	10934	10821				short gene
BBH15	11005	10913				short gene
BBH16	11068	11187				short gene
BBH17	11837	12025				short gene
BBH18	12105	13217			69	N-terminal lipidation consensus
BBH18.1	13571	13693			65	pseudogene; N-terminus inverted
BBH19	13590	13709				questionable gene; overlaps BB18.1 partly in-frame
BBH20	14596	13840			171	pseudogene
BBH20.1	14750	15300			104	pseudogene
BBH21	--	--				No longer considered to be a realistic potential gene.
BBH22	14870	14766				questionable gene; inside BBH20.1 backwards
† BBH23	15051	15158			104	questionable gene; inside of and in-frame with pseudogene BBH20.1
† BBH24	15136	15342			104	questionable gene; mostly inside, in-fame with pseudogene BBH20.1
BBH24.1	15354	15750			86	pseudogene
BBH25	15810	15568				questionable gene; inside BBH24.1 backwards
BBH26	16519	17412			62
BBH27	17408	17971			50
BBH28	17947	18699	plasmid partition protein {Bacillus subtilis}		32	putative plasmid partition function
BBH29	18798	19424			49
BBH30	20871	20415			96	pseudogene
BBH31	20997	21104				short gene
BBH32	21470	22216			60	N-terminal lipidation consensus
BBH33	22678	22950			61	pseudogene
BBH34	23383	23192			62	pseudogene
BBH35	23447	23560				short gene
† BBH36	24180	24031			44	questionable gene; in-frame, inside of BBH36.1
BBH36.1	24223	24041			44	pseudogene
BBH36.2	24751	25112			102	pseudogene
BBH37	26371	25436			12	N-terminal lipidation consensus
BBH38	26614	26498				short gene
BBH39	26754	26855				short gene
BBH40	27445	26981	transposase-like protein {Anabena}		82	pseudogene
BBH41	28197	27628			48

lp28-4
BBI01	174	605			57	pseudogene
BBI02	736	1101			84	(pseudogene [57]?)
BBI02.1	1416	1346			172	pseudogene
BBI02.2	1617	1862			57	pseudogene
BBI03	1972	1850				short gene
BBI04	2219	2127				short gene
BBI05	2310	2191				short gene
BBI06	2536	3348	pfs-I protein {Escherichia coli}		26	putative 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase
BBI07	3441	3346				short gene
BBI08	3576	3752				questionable gene; overlaps BBI08.1
BBI08.1	3674	4314			59	pseudogene
† BBI09	3745	3879			59	questionable gene; in-frame inside of pseudogene BBI08.1
† BBI10	3911	4312			59	questionable gene; in-frame inside of pseudogene BBI08.1
BBI11	4721	4626				short gene
BBI12	5128	5343				short gene
BBI13	5609	5704	IS9016 (V-4) orf1 {Haemophilus influenzae} (very small similarity)			short gene
BBI14	6159	6269			60	N-terminal lipidation consensus; pseudogene
BBI15	6603	6830			60	pseudogene
BBI16	7183	8535			60	N-terminal lipidation consensus; contains 22 internal tandem repeats of 27 bp sequence that is not in other members of family [60]
BBI17	8967	8824				short gene
BBI18	10647	10498				short gene
BBI19	10749	11924			57
BBI20	11924	12475			50
BBI21	12454	13203	plasmid partition protein {Bacillus subtilis}		32	putative plasmid partition function
BBI22	13265	13834			49
BBI23	13989	14090				short gene
BBI24	14334	14438				short gene
BBI25	15211	15339				short gene
BBI26	15352	16527	multidrug-efflux transporter tetA(B) {Helicobacter pylori}		105	putative multidrug-efflux transporter
BBI27	17272	17096			60	pseudogene
BBI28	17874	17305			60	N-terminal lipidation consensus
BBI29	19183	18521			60	N-terminal lipidation consensus
BBI30	19403	19507			168
BBI31	20127	19618			48	N-terminal lipidation consensus
BBI31.1	20240	20340			98	pseudogene
BBI32	20479	20273				N-terminal lipidation consensus; questionable gene; backwards inside BBI31.1
BBI33	20482	20589	transposase-like protein {Anabena}		82	pseudogene
BBI34	21562	20774			60	N-terminal lipidation consensus
BBI35	21992	22090			93	questionable gene; paralog not called in paralogous sequence
BBI36	22931	22098			54	N-terminal lipidation consensus
BBI37	23056	23154			93	questionable gene; paralog not called in paralogous sequence
BBI38	23995	23162			54	N-terminal lipidation consensus
BBI39	25089	24226			54	N-terminal lipidation consensus
BBI40	25320	25802			49	pseudogene
BBI41	26036	25797	transposase-like protein {Anabena}		82	pseudogene
BBI42	26360	26911			52	pseudogene; N-terminal lipidation consensus
BBI43	27069	26884			55	pseudogene?; short gene

lp36
BBK001	86	14	transposase-like protein {Anabena}		82	pseudogene
BBK01	188	1078			12	N-terminal lipidation consensus
† BBK02	2478	1213			1	questionable gene; in-frame inside of BBK02.1
BBK02.1	3770	1213			1	pseudogene
† BBK03	3222	2821			1	questionable gene; in-frame inside of BBK02.1
† BBK04	3595	3419			1	questionable gene; in-frame inside of BBK02.1; near N-terminal lipidation consensus
BBK05	5096	4905				short gene
BBK06	5126	5233				short gene
BBK07	6040	5291			59	N-terminal lipidation consensus
BBK08	6281	6180				short gene
BBK09	6366	6647				short gene
BBK10	6983	6807			1	pseudogene
BBK11	6956	7060				short gene
BBK12	7335	8030			59	N-terminal lipidation consensus
BBK13	8880	8167	protein slr1258 Synechocystis PCC6803}		40
BBK14	8921	9013				short gene
BBK15	9373	9996			60
BBK16	10223	10101	plasmid partition protein {Bacillus subtilis}		32	pseudogene
BBK17	10301	11944	adenine deaminase {Bacillus subtilis}		61	putative adenine deaminase
BBK18	12143	12054	hypothetical protein {Cyanidium caldarium} (very small similarity)			short gene
BBK19	12602	13234				N-terminal lipidation consensus
BBK20	13212	13301				short gene
BBK21	14326	13580	plasmid partition protein {Bacillus subtilis}		32	putative plasmid partition function
BBK22	14841	14305			50
BBK23	15760	14837			62
BBK24	16275	16883			49
BBK24.1	17380	17580				questionable gene; backwards inside BBK25
BBK25	17565	16969	transposase-like protein {Anabena}		82	pseudogene
BBK25.1	17880	20033			1	pseudogene
† BBK26	18346	18462			1	questionable gene; in-frame inside of BBK25.1
BBK27	19094	18807				questionable gene; backwards inside BBK25.1
† BBK28	19232	19348			1	questionable gene; in-frame inside of BBK25.1
† BBK29	19807	19718			1	questionable gene; in-frame inside of BBK25.1
† BBK30	19935	20033			1	questionable gene; in-frame inside of BBK25.1
BBK31	20026	20166				short gene
BBK32	20389	21450		P47 (P35 in N40)		fibronectin-binding protein; surface localized (Probert and Johnson, 1998); upregulated in stationary phase in N40 (Fikrig et al., 1997; Indest et al., 1997); near-consensus N-terminal lipidation signal
BBK33	21720	21890			65	pseudogene
BBK34	21912	22130			64	short gene
BBK35	22294	22464			68	short gene
BBK36	22545	22646			66	short gene
BBK37	23953	22913			75 & 175	pseudogene
BBK38	24146	23922				short gene; near-consensus N-terminal lipidation signal
BBK39	24293	24667			59	pseudogene
BBK40	25103	25654		bdrX	58/80	has family 80-like repeats
BBK41	26379	25816			70
BBK42	26803	26588			71	short gene
BBK42.1	26916	27078			72	short gene
† BBK43	26937	27041			72	questionable gene; largely overlaps BBK42.1 in-frame
BBK44	27234	27350			100	short gene
BBK45	28315	27386			75	near-consensus N-terminal lipidation signal
BBK46	29212	28394			75	pseudogene; authentic frameshifts
BBK47	30463	29480			69	N-terminal lipidation consensus
BBK48	31585	30722			75	N-terminal lipidation consensus
BBK49	32822	31830			69	N-terminal lipidation consensus
BBK50	34079	33084		P37 (N40)	75	N-terminal lipidation consensus; (Fikrig et al., 1997)
BBK51	34232	34327				short gene; near-consensus N-terminal lipidation signal
BBK52	35443	34598		P23 (297)	44	N-terminal lipidation consensus; previously only sequenced in strain 297 (Akins et al., 1994)
BBK52.1	35722	35811			174	authentic frameshift
BBK53	35868	36419			52	N-terminal lipidation consensus
BBK54	36577	36392			55	pseudogene?

lp38
BBJ001	482	1208			60	N-terminal lipidation consensus; pseudogene
† BBJ01	482	664			60	questionable gene; in-frame and inside of BBJ001 pseudogene; N-terminal lipidation consensus
† BBJ02	927	1208			60	questionable gene; in-frame and inside of BBJ001 pseudogene
BBJ02.1	1475	2367			48	pseudogene
† BBJ03	1593	1742			48	questionable gene; in-frame and inside of BJ02.1 pseudogene
BBJ04	2381	2271				N-terminal lipidation consensus; questionable gene; backwards inside BBJ03.2
BBJ05	3828	2768	transposase-like protein {Anabena}		82	pseudogene
BBJ06	3486	3629				questionable gene; backwards inside BBJ05; near-consensus N-terminal lipidation signal
BBJ07	4307	4167			98	questionable gene; in-frame and inside of BBJ07.1
BBJ07.1	4409	4167			98	pseudogene
BBJ08	4576	5493			12	near-consensus N-terminal lipidation signal
17 bp repeat	5938	6063				7.6 repeats of the 17 bp sequence AATTGATATTAAAATAT; not in a gene
BBJ09	6089	6859		ospD		outer surface protein; N-terminal lipidation consensus; rather extensive short direct repeat upstream of gene (Marconi et al., 1994; Norris et al., 1992)
BBJ10	7270	7473		bdrY	58	pseudogene
BBJ11	7965	7783				short gene
(BBJ11.1)	8070	8260			171	possible pseudogene, but too weak a match to be in the TIGR master gene list
BBJ12	8725	8636			86	questionable gene; inside BBJ12.1
BBJ12.1	8782	8593			86	pseudogene
BBJ13	9155	8880			69	pseudogene
BBJ14	9125	9283	protein urf (51aa) {Thermoproteus tenax virus} (poor match)			questionable gene; overlaps BBJ13 backwards
BBJ15	10168	10043				questionable gene; backwards inside BBJ15.1)
BBJ15.1	9450	10150	multidrug-efflux transporter tetA(B) {Helicobacter pylori}		105	pseudogene
7 bp repeat	10287	10373				12.3 repeats of the 7 bp sequence TAATAGT; not in a gene
BBJ16	11105	10521			49
BBJ17	11889	11155	plasmid partition protein {Bacillus subtilis}		32	putative plasmid partition function
BBJ18	12452	11865			50
BBJ19	13440	12448			62
BBJ20	13936	13775			167	pseudogene
BBJ21	15514	15657				questionable gene; backwards inside BBJ21.1
BBJ21.1	15976	15484			138	pseudogene
BBJ22	16003	15905				questionable gene; overlaps BBJ21.1
BBJ23	16505	17326			106	near-consensus N-terminal lipidation signal
BBJ24	17388	18167			106
BBJ25	18202	19251
BBJ26	19313	20005	ABC transporter, ATP-binding protein {Methanococcus jannaschii}		4	putative ABC transporter, ATP- binding subunit
BBJ27	19995	21227
BBJ28	21220	21945
BBJ29	21971	23005			90
BBJ30	23018	23119			91	short gene
BBJ31	23366	24085			59
BBJ32	24517	24389			173	short gene
BBJ33	24681	24791				short gene
BBJ34	26407	25340			92	N-terminal lipidation consensus
BBJ35	26858	26959				short gene
BBJ36	28053	26998			92	N-terminal lipidation consensus
BBJ37	28442	28281				short gene
BBJ38	28703	28608				short gene
BBJ39	29401	29267				short gene
BBJ39.1	29800	29600			54	pseudogene
BBJ40	29827	29919				questionable gene; ; no gene called in paralogous sequence
BBJ41	30771	29908			54	N-terminal lipidation consensus
BBJ42	31133	30945			(54?)	pseudogene if weak similarity to family 54 is real; not in TIGR master paralog list
BBJ43	31220	32137			90
BBJ44	32150	32251			91	short gene
BBJ45	32498	33217			59
BBJ45.1	33652	33522			173	pseudogene in [J32]
BBJ46	34668	34375				short gene
BBJ47	35591	34908			99	near-consensus N-terminal lipidation signal
BBJ48	36272	35637
BBJ49	36455	36315			92	pseudogene
BBJ50	36502	37203		BbK2.5-6		BBJ50 has "authentic frameshifts" relative to outer membrane protein gene BbK2.5-6 which was sequenced from strain 297 (accession #L31615)
BBJ51	37917	37418			171	pseudogene

lp54						lp54-like plasmids have been found in almost all Bb (sensu lato) isolates analyzed (e.g., Casjens et al., 1995; Marconi et al., 1996a; Mathiesen et al., 1997; Samuels et al., 1993)
BBA01	588	1070		p11/S3 (N40)	48	S3 does not correspond perfectly to BBA01 (Feng et al., 1996)
BBA02	1238	1122				short gene; Feng et al. (1996); recognized a different small ORF called S4 (or p5) in this region in strain N40
BBA03	1397	1903		BbK2.14 (297)		near-consensus N-terminal lipidation signal; not labeled with palmitate (Akins et al., 1995a)
BBA04	2829	1984		S2 (N40)	44	N-terminal lipidation consensus
BBA05	4192	2942		S1 (N40)		N-terminal lipidation consensus (Feng et al., 1995)
BBA06	4342	4226				short gene
BBA07	5091	4606	chpAI protein {Escherichia coli} (chpAI similar only to central region of BBA07; best guess is that this is false hit)			N-terminal lipidation consensus; patchy homolog chpAI does not have a lipidation consensus.
BBA08	5250	5582			139	has cp32 paralog
BBA09	5582	6451			140	has cp32 paralog
BBA10	6457	7080			141	has cp32 paralog
BBA11	7145	8176			142	has cp32 paralog
BBA12	8202	8378				short gene
BBA13	8378	8800
BBA14	8793	9155			143	N-terminal lipidation consensus; has cp32 paralogs but they do not have lipidation consensus
BBA15	9393	10211		ospA	53	outer surface protein (Barbour et al., 1983); N-terminal lipidation consensus and lipidated in Bb; (Bergstrom et al., 1989; Brandt et al., 1990); transcription start site mapped (Jonsson et al., 1992); sequenced in numerous other strains (Bunikis et al., 1996; Caporale and Kocher, 1994; Jonsson et al., 1992; Marconi et al., 1993a; Rosa et al., 1992; Wallich et al., 1992; Wallich et al., 1989; Wang et al., 1997a; Wang et al., 1997b; Wang et al., 1997c; Will et al., 1995; Wilske et al., 1996a; Wilske et al., 1996b; Wilske et al., 1992; Zumstein et al., 1992); atomic resolution structure (Li et al., 1997); in vitro mutagenesis (McGrath et al., 1995)
BBA16	10224	11111		ospB	53	outer surface protein (Barbour et al., 1984); N-terminal lipidation consensus (Bergstrom et al., 1989)
BBA17	11390	11301				short gene
BBA18	11687	12880			57	has cp32 paralog
BBA19	12931	13512			50	has cp32 paralog
BBA20	13491	14240	plasmid partition protein {Bacillus subtilis}		32	putative plasmid partition function; has cp32 paralog
BBA21	14274	14816			49	has cp32 paralog
BBA22	15084	15239				short gene
BBA23	15294	15734			144	has cp32 paralog
BBA24	16512	15940		dbpB (297)	74	N-terminal lipidation consensus; binds decorin (Guo et al., 1998)
BBA25	17195	16635		dbpA (297)	74	N-terminal lipidation consensus, surface exposed on outer membrane, binds decorin (Guo et al., 1998; Hagman et al., 1998; Hanson et al., 1998)
BBA26	17386	17514				short gene
BBA27	17563	17679				short gene
BBA28	17906	17757				short gene
BBA29	18019	17897				short gene
BBA30	18064	18654
BBA31	18661	20010	protein Orf26 of phage fO1205 {Streptococcus thermophilus}		145	homolog of phage Streptococcus thermophilus fO1205 gene orf26 that is likely to be a terminase subunit
11 bp repeat	20138	20216				7.1 repeats of TAAATCAATAT; not in a gene
BBA32	20654	20845				short gene; near-consensus N-terminal lipidation signal
BBA33	21023	21559				N-terminal lipidation consensus
BBA34	23209	21623	oligopeptide ABC transporter, periplasmic oligopeptide-binding protein {Escherichia coli}	oppAV	37	N-terminal lipidation consensus (Bono et al., 1998)
BBA35	23391	23284				short gene
BBA36	23710	24348				N-terminal lipidation consensus; has weak similarity to family 113
BBA37	24434	25036
BBA38	25389	26627			146	has cp32 paralog
BBA39	26642	27226			147	has cp32 paralog
BBA40	27326	27931			148	has cp32 paralog
BBA41	27950	28864			149	has cp32 paralog
BBA42	28871	29320			150	has cp32 paralog
BBA43	29320	29691			107	has cp32 paralog
BBA44	29688	30005
BBA45	30030	30566			151	has cp32 paralog
BBA46	30646	31713			152	has cp32 paralog
BBA47	31716	32135			153	has cp32 paralog
BBA48	32197	32682			154	has cp32 paralog
BBA49	32678	32893			155	short gene; has cp32 paralog
BBA50	32905	34299
BBA51	34321	34881			157	has cp32 paralog
BBA52	34924	35766		BK2.1 (297)		(Akins et al., 1993)
BBA53	35890	36162			158	short gene
BBA54	36192	36467			158	short gene; near-consensus N-terminal lipidation signal
BBA55	36558	37484			159	has cp32 paralog
BBA56	37477	38043			160	has cp32 paralog
BBA57	39341	38100				N-terminal lipidation consensus
BBA58	39566	39766				short gene
BBA59	40048	39812		12 kd lipoprotein		N-terminal lipidation consensus; short gene but its real and expressed; (McGrath et al., 1997)
BBA60	40981	40151		P27 (B29)		N-terminal lipidation consensus, lipidated in Bb, surface exposed (Reindl et al., 1993)
BBA61	41955	41335		D6 (B. garinii VS102)		(Balmelli et al., 1996)
BBA62	42203	42406		7.5 kd; 6.6 kd (297)		N-terminal lipidation consensus; lipidated in Bb, possible surface exposure, short gene (Katona et al., 1992; Lahdenne et al., 1997); transcription start (Indest et al., 1997)
BBA63	42576	42454				short gene
BBA64	43483	42563		P35 antigen	54	N-terminal lipidation consensus; (Gilmore et al., 1997); cell density-dependent expression and transcription start (Indest et al., 1997)
BBA65	44469	43624			54	N-terminal lipidation consensus
BBA66	45883	44651			54	N-terminal lipidation consensus
BBA67	46021	46197				short gene
BBA68	47164	46412			54	N-terminal lipidation consensus
BBA69	48203	47415			54	N-terminal lipidation consensus
BBA70	49158	48523			54	pseudogene
BBA71	49796	49386			54	pseudogene
BBA72	50031	49792				short gene; near-consensus N-terminal lipidation signal
BBA73	51112	50225			54	N-terminal lipidation consensus
BBA74	51642	52412		oms28	171	outer membrane protein with porin activity (Skare et al., 1996)
BBA75	52591	52496				short gene
BBA76	52642	53436	thymidylate synthase-complementing protein (thy1) {Dictyostelium discoideum}		65	one patch of similarity to thy1

lp56						Hinnebusch et al. (1990) determined the sequence of what turned out to be the right telomere of lp56 - this sequence (called TL49 in that paper) adds 25 bp to the right end of the TIGR sequence
BBQ01	279	545			55	pseudogene?
BBQ02	710	799			174	questionable gene; paralog not called in similar sequence elsewhere
BBQ03	856	1404			52	N-terminal lipidation consensus
BBQ04	1404	2265			44	pseudogene; authentic frameshift; N-terminal lipidation consensus
BBQ05	2744	3493			60	N-terminal lipidation consensus
BBQ06	3623	4105			48
BBQ07	4986	4252			49
BBQ08	5830	5072	plasmid partition protein {Bacillus subtilis}		32	putative plasmid partition function
BBQ09	6339	5806			50
BBQ10	6674	6339			62	pseudogene; fusion protein resulting from integration of a cp32-like plasmid into the linear lp56 precursor
BBQ11	6585	6800			148	pseudogene; result of integration of a cp32-like plasmid into the linear lp56 precursor
BBQ12	6800	7408			148
BBQ13	7418	8389			149
BBQ14	8406	8864			150
BBQ15	8849	9247			107
BBQ16	9238	9624			108	pseudogene; authentic frameshift
BBQ17	9624	10187			151
BBQ18	10171	11280			152
BBQ19	11276	11722			153
BBQ20	11741	12193			154
BBQ21	12193	12426			155	short gene
BBQ22	12437	13729			156
BBQ23	13755	14435			157
BBQ24	14442	15389			159
BBQ25	15410	15961			160
BBQ26	15994	16323			139
BBQ27	16323	17195			140
BBQ28	17208	17810			141
BBQ29	17823	18635			142
BBQ30	18713	18913		blyA-56	109	putative hemolysin; short gene
BBQ31	18920	19264		blyB-56	111	putative hemolysin
BBQ32	19257	19589			112
BBQ33	19579	19935			143	near-consensus N-terminal lipidation signal
BBQ34	20022	20735		bdrW	80	contains ~7 repeats of a 33 bp sequence
BBQ35	20844	21452		mlpJ	113	N-terminal lipidation consensus
BBQ36	21424	21513				questionable gene; gene not called in paralogous sequence on other cp32s
BBQ37	22479	21535		orf4-56	161	(Zuckert and Meyer, 1996)
BBQ38	22869	23963		orf1-56	57	(Zuckert and Meyer, 1996)
BBQ39	23976	24539		orf2-56	50	(Zuckert and Meyer, 1996)
BBQ40	24518	25270	plasmid partition protein {Bacillus subtilis}	orfC-56	32	putative plasmid partition function (Zuckert and Meyer, 1996)
BBQ41	25317	25874		orf3-56	49	(Zuckert and Meyer, 1996)
BBQ42	25890	26423		bdrV	80	(Zuckert and Meyer, 1996)
BBQ43	26879	28243		orf8/7-56	165	(Zuckert and Meyer, 1996)
BBQ44	28299	28721			144
BBQ45	29506	28733			96
BBQ46	29559	29651				questionable gene; gene not called in paralogous sequence on other cp32s; near consensus lipidation sequence
BBQ47	29895	30971		erpX	163	N-terminal lipidation consensus (Stevenson et al., 1998a)
BBQ48	31117	31707			114
BBQ49	31892	32455			115
BBQ50	32455	33804	hypothetical protein Orf26 of phage fO1205 gene {Streptococcus thermophilus}		145	phage fO1205 Orf26 homology; Orf26 is a possible phage structural protein
BBQ51	33873	35095			146	pseudogene; authentic frameshift
BBQ52	35115	35804			147
BBQ53	35819	36382			148
BBQ54	36388	37132			148	pseudogene; result of integration of a cp32-like plasmid into the linear lp56 precursor
BBQ55	37533	36933			62	pseudogene; result of integration of a cp32-like plasmid into the linear lp56 precursor
BBQ56	37809	37672				near-consensus N-terminal lipidation signal; short gene
† BBQ57	38223	37819			101	questionable gene; in-frame and inside of BBQ60
† BBQ58	38514	38419			101	questionable gene; in-frame and inside of BBQ60
† BBQ59	39077	38568			101	questionable gene; in-frame and inside of BBQ60
BBQ60	39360	37817			101	pseudogene
† BBQ61	39482	39360			117	questionable gene; in-frame and inside of BBQ63
BBQ62	39531	39902				questionable gene; backwards in BBQ63
BBQ63	39934	39400			117	pseudogene
† BBQ64	40186	39962			103	questionable gene; in-frame and inside of BBQ65
BBQ65	40218	39961			103	pseudogene
BBQ66	40317	40409				short gene
BBQ67	43732	40439	C-terminal portion — adenine specific DNA methyltransferase {Helicobacter pylori} N-terminal portion hits gene HP1353 {Helicobacter pylori}		102/ 167	probable pseudogene or fusion gene; N-terminal portion is good match to adenine specific DNA methyltransferase; C-term is good match to BBG02 which matches H. pylori HP1353 and HP1352 & HP1354 are putative adenine methylases!
† BBQ68	44232	43918			138	questionable gene; in-frame and part of BBQ69
BBQ69	44581	43769			138	pseudogene
† BBQ70	44612	44511				questionable gene; in-frame and overlaps Q69 (in part)
BBQ71	44582	45263	multidrug-efflux transporter tetA(B) {Helicobacter pylori}		105	pseudogene
BBQ72	45314	45427				short gene
BBQ73	45630	45530			60	pseudogene
BBQ74	46462	45804			60	pseudogene
BBQ75	46671	46781			168	pseudogene
BBQ76	46982	47077				short gene
BBQ77	47163	47279	transposase-like protein {Anabena}		82	pseudogene contains a fragment of [82] in middle; probably actually part of BBQ80 pseudogene
BBQ78	47295	47393				questionable gene; out of frame inside BBQ81
BBQ79	47273	47569	transposase-like protein {Anabena}		82	pseudogene (see BBQ77 comment)
BBQ80	48626	47787			60	pseudogene
BBQ81	49246	49047			48	pseudogene
BBQ82	49538	49347			76	pseudogene
BBQ83	49868	49755				short gene
BBQ84	50550	50398			84	short gene (pseudogene [57])
BBQ84.1	50900	50700			57	pseudogene
BBQ85	51528	51175			57	pseudogene
BBQ86	51823	51722			57	pseudogene
BBQ87	52067	51921			57/77	pseudogene
BBQ88	52608	52138			76
BBQ89	52726	52535			166	short gene; N-terminal lipidation consensus

Right 7.2 kbp of B31 chrm			Note that "genes" BB0850 and BB851 in this region have been removed from the published (Fraser et al., 1997) gene list due to improvements in the TIGR gene-calling protocol.			The rightmost 7.2 kbp of the B31 chromosome contains largely plasmid-like sequences, many of which are pseudogenes. This is not true of the remainder or "constant portion" of the chromosome, including sequences near the left chromosomal end.
BB0843.1	903255	903415			32	pseudogene
BB0844	904900	903932			12
BB0845	905120	905224				questionable gene; inside BB0845.1 and backwards
BB0845.1	905255	905025			76	pseudogene
BB0845.11	905395	905295			166	possible pseudogene; this is a poor homolog and is not included in the TIGR analysis.
BB0845.2	905475	905775			105	pseudogene
BB0846	905865	905755				questionable gene; overlaps BB 845.2 backwards
BB0847	905839	905943				short gene
BB0848	905928	906029				short gene
BB0848.1	906075	906275			82	pseudogene
BB0849	906162	906260				questionable gene; inside BB 848.1
BB0849.1	906725	906275			57	pseudogene
BB0849.2	907225	908225			1	pseudogene
BB0850	——	——				No longer considered to be a realistic potential gene.
BB0851	——	——				No longer considered to be a realistic potential gene.
BB0852	908407	909588			138
BB0853	910175	909845			57	pseudogene
BB0853.1	910555	910375			57	pseudogene

Part II

1. Any pair of B31 proteins whose comparison scored better than 0.02 probability by FASTA3 was clustered. Any additional protein similar to (with better than 0.02 probability) any member of an existing cluster joined that cluster. Therefore each protein is a member of AT MOST a single cluster (no cluster is linked to any other cluster by a score better than 0.02). However clusters may fail to be closed under transitivity, that is, if protein A scores >0.02 with B, and B scores >0.02 with C, A does not necessarily score >0.02 with C.

2. This preliminary clustering was followed by manual curation of amino acid sequence alignments. Final clusters were generated by parsing the approved alignments. Curation was as follows: For each initial cluster, multiple sequence alignments were generated by CLUSTALW and by a TIGR program called MSA (G. Sutton, unpublished; not to be confused with another MSA program) that runs on the MASPAR. The better of the two alignments was selected by inspection of both. Sometimes manual editing was performed to improve the alignment further.

3. Adjustments to the paralogous families were achieved by splitting clusters, not joining them or adding proteins to clusters (with a single exception, in which one additional GTP-binding protein was added to the cluster of all other GTP-binding proteins). The standard for splitting versus not splitting was as follows: Alignments were viewed in BELVU, which could be used to generate a UPGMA difference tree (which is NOT a phylogenetic tree). In some cases, a domain could be recognized that was responsible for the initial clustering. If large portions of the resulting alignment contained protein sequence that clearly was not homologous, although aligned, these were split. This happened most often for plasmid proteins that shared similar amino-terminal domains (signal and lipidation sequences), but that otherwise were easily resolvable into several different classes. Two notable cases, genes BBR41 and BBQ76, appear to be gene fusions that join large, easily recognizable parts of two genes that fall into two different paralogous families; thus, even though, for example BBR41 bridges two families by virtue of its two different domains, these two families were not joined since they have no similarity to one another.

Why are some numbers not used in the current set of paralogous family names?

The methods TIGR uses to classify paralogous gene family members has changed somewhat since Fraser et al. (1997) was published. Where possible, the gene family names in that paper are used here. In cases where two or more families have fused since that publication, we chose one of the previous family names and have not re-used the others. Hence, not all numbers are currently used in the list of family names; 161 of the numbers between 1 and 175 are currently used as family names (the numbers 5, 7, 17, 24, 27, 28, 51, 67, 73, 79, 81,83, 87, 169, etc., are not used).

There are 161 paralogous families of B. burgdorferi B31 genes, 107 of which have plasmid borne members. The family sizes vary from 2 members to 41 members. Family 57 has 41 members of which only 16 appear to be full-length, intact genes. Some families have noticeable subgroups that are not delineated here - for, example, family 148 (26 members of which 24 are intact) has three clear subgroups each of which has 8 members (these subgroups coincide with three continuous related genes on each of the cp32’s and on lp56).

family	total genes	pseudogenes	apparently intact genes
32	29	4	25
49	26	6	20
50	23	3	20
54	14	4	10
57	41	25	16
60	15	6	9
62	12	3	6
80	18	1	17
82	17	17	0

It is curious to note that five of the above families (32, 49, 50 and 57) are members of the so-called "partition gene cluster" (Zuckert & Meyer, 1996; Casjens et al., 1999), intact variants of which are found on all or most of the B31 plasmids.

Most plasmid genes are members of paralogous families. Only 63 of the 535 plasmid non-pseudogenes >300 bp that have no paralogs, and 93 of the 134 ²300 bp non-pseudo genes have no paralogs.

BBB01, BBB02, BBB03, BBB04, BBB05, BBB06, BBB07, BBB08, BBB09, BBB14, BBB17, BBB18, BBB19, BBB24, BBB25, BBB26, BBB27, BBB28, BBS27, BBM39, BBD09, BBD10, BBD11, BBD13, BBD18, BBE17, BBE22, BBG12, BBG13, BBG14, BBG15, BBG16, BBG17, BBG18, BBG21, BBG26, BBG27, BBG28, BBG30, BBH06, BBK19, BBK32, BBJ09, BBJ25, BBJ27, BBJ28, BBJ48, BBA03, BBA05, BBA07, BBA13, BBA30, BBA33, BBA36, BBA37, BBA44, BBA50, BBA52, BBA57, BBA59, BBA60, BBA61, BBA62.

•••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••••

LP - Indicates that the gene contains a "perfect" lipoprotein consensus (see PART III).

LP? - Indicates that the gene contains an "imperfect" but near-consensus lipidation sequence (see PART III). Cross referencing of this feature into gene families without plasmid members was not performed.

† - Daggers indicate genes inside of a larger pseudogene (i.e., are part of a larger entity that is also in the gene list).

(...) - Gene names in parentheses are not in this location in the TIGR paralog list - see comments column in those cases.

Paralogous Family Name	Member Genes and Pseudogenes*	Comments
1 family	BB0849.2* BBE02 BBH09 BBH11.1* BBK02.1* †BBK02* †BBK03* †BBK04* BBK10* BBK25.1* †BBK26* †BBK28* †BBK29* †BBK30*	7 members
‡2 family	BB0246 BB0255 BB0262 BB0761	4 members
‡3 family	BB0611 BB0757	2 members
4 family	BB0080 BB0146 BB0218 BB0318 BB0334 BB0335 BB0466 BB0573 BB0642 BB0677 BB0742 BB0754 BBJ26	13 members
‡6 family	BB0020 BB0727	2 members
‡8 family	BB0302 BB0719	2 members
‡9 family	BB0264 BB0518 BB0715	3 members
‡10 family	BB0076 BB0270 BB0694	3 members
‡11 family	BB0088 BB0540 BB0691	3 members
12 family	BB0844LP BBG01LP BBH37LP BBJ08LP? BBK01*LP	5 members; All are fairly near a telomere, transcribed towards center of plasmid.
‡13 family	BB0578 BB0596 BB0597 BB0680 BB0681	5 members
‡14 family	BB0419 BB0420 BB0551 BB0570 BB0672 BB0763	6 members
‡15 family	BB0517 BB0655	2 members
16 family	BB0116 BB0645 BBB29	3 members
‡18 family	BB0344 BB0607	2 members
‡19 family	BB0408 BB0629	2 members
‡20 family	BB0581 BB0623	2 members
‡21 family	BB0002 BB0620	2 members
‡22 family	BB0253 BB0613	2 members
‡23 family	BB0369 BB0834	2 members
‡25 family	BB0137 BB0593	2 members
26 family	BB0375 BB0588 BBE07* BBI06	4 members
‡29 family	BB0451 BB0452	2 members
‡30 family	BB0036 BB0436	2 members
‡31 family	BB0035 BBB0435	2 members
32 family	BB0269 BB0361 BB0431 BB0726 BB0843.1* BBA20 BBB12 BBD21 BBE19 BBE23.2* BBF11.1* BBF13 BBF24 BBG08 BBH28 BBI21 BBJ17 BBK16* BBK21 BBL32 BBM32 BBN32 BBO32 BBP32 BBQ08 BBQ40 BBR33 BBS35 BBU05	29 members; Previously called ORF-C (Zuckert and Meyer, 1996) Homology to parA genes in other bacterial systems suggests these genes function in plasmid partitioning. BBD21 is fairly distant member
‡33 family	BB0040 BB0312 BB0414 BB0565 BB0670	5 members
‡34 family	BB0738 BB0833	2 members
‡35 family	BB0405 BB0406 BB0562 BB0563 BB0564	5 members
‡36 family	BB0382 BB0383 BB0384 BB0385	4 members
37 family	BB0328LP BB0329LP? BB0330LP? BBA34LP BBB16LP	5 members; oppA homologous genes (oligopeptide ABC transporter)
‡38 family	BB0221 BB0290	2 members
‡39 family	BB0093 BB0094 BB0288	3 members
40 family	BB0223 BB0224 BBK13	3 members
‡41 family	BB0145 BB0216 BB0217 BB0332 BB0333 BB0640 BB0641 BB0746 BB0747	9 members
‡42 family	BB0059 BB0202	2 members
‡43 family	BB0074 BB0196	2 members
44 family	BB0158LP BB0159 BBA04LP BBE04.1LP †BBE05 BBE09LP BBF22* †BBH36* BBH36.1* BBK52LP BBQ04*LP	9 members; BBA04 protein is "S2 antigen"
‡45 family	BB0018 BB0815	2 members
46 family	BB0111 BBG32	2 members; These proteins are homologs to helicases; lipidation seems unlikely
‡47 family	BB0050 BB0051	2 members
48 family	BB0034 BBA01 BBG03* BBH41 BBI31 BBJ02.1* †BBJ03* BBQ06 BBQ81*	9 members; BBG03* has patchy similarity to family and is slightly truncated at N-terminus
49 family	BBA21 BBB13 BBC03 BBE18 BBE24* BBE24.1* BBE30* BBF12(?) BBF23 BBF29 BBG09 BBH29 BBI22 BBI40* BBJ16 BBK24 BBL34 BBM33 BBN33 BBO33 BBP33 BBQ07 BBQ41 BBR34 BBS36 BBU06	26 members Previously called ORF-3 (Dunn et al., 1994; Zuckert and Meyer, 1996); BBF12 is very patchy paralog (fusion pseudogene?); BBE24.1 is a fragment of BBF12 that is not very related to the rest of the family; BBF29 is patchy paralog (fusion pseudogene?)
50 family	BBA19 BBB11 BBC02 BBE20 BBF14 BBF25 BBF31* BBG07 BBG31* BBH07* BBH27 BBI20 BBJ18 BBK22 BBL31 BBM31 BBN31 BBO31 BBP31 BBQ09 BBQ39 BBR32 BBS34	23 members Previously called ORF-2 (Dunn et al., 1994; Zuckert and Meyer, 1996).
51		no longer exists - merged into family 62
52 family	BBI42LP BBJ50* BBK53LP BBQ03LP BBT07* BBU12*	6 members; BBJ50* is fairly distant member of family
53 family	BBA15LP BBA16LP	2 members; ospA & ospB genes
54 family	BBA64LP BBA65LP BBA66LP BBA68LP BBA69LP BBA70* BBA71* BBA73LP BBE04LP? BBI36LP BBI38LP BBI39LP BBJ39.1 BBJ41LP (BBJ42*?)	14 members Only BBA64, BBA65, BBA66 and BBA73 have a "standard" lipidation consensus; BBA68, BBA69, BBI36, BBI38, BBI39 and BBJ41 have sequences that fit a slightly relaxed consensus; Includes "old family 87"; BBJ42* has very weak homology to family 54; it is not included in the TIGR computer’s paralog list.
55 family	BBC08 BBI43() BBK54() BBQ01() BBU09()	5 members; A confusing family - it demonstrates the problems involved in attempting to make gene/pseudogene decisions on novel DNA sequence for which there is no information beyond sequence: relative sizes are BBC08 > BBU09>BBK54=BBI43=BBQ01; I called the shortest 4 pseudogenes, but obviously no one really knows; it is possible that BBC08 is unusually large for an as yet unknown reason.
‡56 family	BB0473 BB0583 BB0584	3 members
57 family	BB0849.1* BB0853* BB0853.1* BA18 BBC01 (BBD02) BBD03 BBD04* BBD05.1* †BBD06* BBE21 BBE23.1* BBE32* BBE33* (BBF04) BBF05 BBF06* BBF26 BBF31.1* BBG06 (BBH03) BBH04 BBH05* BBI01* BBI02.2* BBI19 BBL30 BBM30 BBN30 BBO30 BBP30 BBQ38 BBQ84.1* BBQ85* BBQ86* (BBQ87) BBR31 BBS33 BBT01 BBT02* BBT04 BBT05* BBU01* BBU04 BBU07* BBU10*	45 members - family 57 is distant relative of family 62 Previously called ORF-1 (Dunn et al., 1994; Zuckert and Meyer, 1996). BBD02, BBF04, BBH03 & BBQ87 (family 77) appear to be fusions of part of a family 57 gene and something else; BBD05, BBI02, BBQ84, BBT03, and BBU02 (family 84) also have weak similarities to family 57. Many of the family 57 members are in highly recombined telomeric regions are perhaps not functional (?) (Casjens et al., 2000).
58 family	BBJ10* BBK40	2 members BBK40 contains repeats that are somewhat similar to BBG33 in family 80
59 family	BBI08.1* †BBI09* †BBI10* BBJ31 BBJ45LP? BBK07LP BBK12LP BBK39*	6 members only BBK07 and BBK39 have good lipidation consensus
60 family	BBE31LP BBH32LP BBI14LP BBI15 BBI16LP BBI27* BBI28LP BBI29LP BBI34LP BBJ001LP †BBJ01LP †BBJ02 BBK15 BBQ05LP BBQ73 BBQ74* BBQ80*	15 members F01 is fairly poor paralog K15 missing LP consenus - is it a pseudogene?
61 family	BBH33* BBK17	2 members
62 family	BBB10 BBD14 BBG29 BBH26 BBH34* BBJ19 BBK23 BBQ10* BBQ55*	9 members - family 62 is related to family 57 Published families 51 and 62 now merged
63 family	BBC10LP BBM27LP BBP27LP	3 members BBP27 is rev gene of (Gilmore et al., 1997)
64 family	BBF16* BBK34	2 members
65 family	BBA76 BBF14.1* BBH18.1* BBK33*	4 members
66 family	BBF21 BBK36	2 members
68 family	BBF17* BBK35	2 members
69 family	BBH18LP BBJ13* BBK47LP BBK49LP	4 members published families 69 & 81 merged
70 family	BBF10 BBK41	2 members
71 family	BBF09* BBK42	2 members
72 family	BBF08* BBK42.1* †BBK43*	2 members complex situation regarding pseudogenes
74 family	BBA24LP BBA25LP	2 members dbpA & dbpB (decorin binding proteins) (Guo et al., 1998)
75 family	BBK37* BBK45LP? BBK46* BBK48LP BBK50LP	5 members BBK45 does not have the lipidation consensus as the gene was originally listed, but it has a near-consensus lipidation signal at alternate translation start (see Part III). BBK37 is truncated and fused to other sequences C-terminal to its family 75 similarity; thus it is also placed in family 175 as well by virtue of similarity to that family at its C-terminus; it looks as though it could be expressed.
76 family	BB0845.1* BBD01 BBH02 BBQ82* BBQ88*	5 members
77 family	BBD02 BBF04 BBH03 BBQ87	4 members These appear to be fusions between family 57 and something else (that is common to family 77 genes); see also comments under family 57
‡78 family	BB0283 BB0293 BB0774 BB0775	4 members
80 family	BBF001.1* BBF03* BBG33 BBH13 (BBK40) BBL27 BBL35 BBM34 BBN27 BBN34 BBO27 BBO34 BBP34 BBQ34 BBQ42 BBR27 BBR35 BBS29 BBS37	19 members Two subfamilies previously typified by ORF-E (Zuckert and Meyer, 1996; Zuckert et al., 1999) and rep (Porcella et al., 1996). Now these are called the bdr genes, for Borrelia direct repeat containing genes (W. Zuckert et al. 1999). Most cp32s carry two homologs in this family called one at or near gene position 28 (rep) and the other at or near gene position 34 (ORF-E). BBK40 (family 58) contains repeats that are somewhat similar to BBG33, but is otherwise not very similar to this family.
82 family	BB0848.1* BBD08* BBD15.1* BBD20* BBD23* BBE21.1* BBF18* †BBF19* BBG05* BBH10.1* BBH40* BBI33* BBI41* BBJ05* BBK001* BBK25* BBQ77* BBQ79*	17 members BBG05 is "best" family member; it has one frameshift relative to homologous putative transposases in some other bacteria. It does not appear that BBG05 could be expressed by programmed translational frameshifting, and so it appears that strain B31 no longer has an intact version of this gene.
84 family	BBD05* BBI02() BBQ84 BBT03() BBU02()	5 members; This group may in fact be part of family 57 since BBI02, BBU02 & BBT03 have weak similarity to the N-terminal region of [57] members; if so then all the genes in family 84 would be pseudogenes. These are all in the highly recombined telomeric regions which may carry no "real" genes (Casjens et al., 2000).
85 family	BBD15LP BBF20*LP	2 members
86 family	BBG22 BBG23 BBH24.1* †BBJ12* BBJ12.1*	4 members
87 family	none	published family 87 (Fraser et al., 1997) merged into family 54
88 family	BBF001* BBF02 BBG34	3 members
‡89 family	BB0712 BB0771	2 members
90 family	BBJ29 BBJ43	2 members
91 family	BBJ30 BBJ44	2 members
92 family	BBJ34LP BBJ36LP BBJ49*	3 members
93 family	BBI35 BBI37	2 members
94 family	BBB22 BBB23	2 members
95 family	BBC06 BBH09.1* BBS42	3 members; BBC06 and BBS42 previously called eppA and bapA, respectively (Champion et al., 1994; Wallich et al., 1995)
96 family	BBC11 BBH30* BBL38 BBM37 BBN37* BBO38 BBP37 BBQ45 BBR38 BBS40	10 members; Previously called ORF-6 (Dunn et al., 1994; Zuckert and Meyer, 1996).
‡97 family	BB0068 BB0421	2 members
98 family	BBE03 BBI31.1* †BBJ07* BBJ07.1*	3 members
99 family	BBE16LP? BBJ47LP?	2 members
100 family	BBF07 BBK44	2 members
101 family	BBF26.1* †BBF27* BBG10 †BBQ57 †BBQ58 †BBQ59 BBQ60*	3 members
102 family	BBE29.1* BBG02LP BBH36.2* (BBQ67*)	4 members The C-terminal portion of BBQ67 is similar to BBG02; the N-terminal part is similar to adenine methylases (see family 167)
103 family	BBG20 †BBQ64 BBQ65*	2 members
104 family	BBG24 BBH20.1* †BBH23* †BBH24*	2 members
105 family	BB0845.2* BBI26 BBJ15.1* BBQ71*	4 members
106 family	BBJ23 BBJ24	2 members
107 family	BBA43 BBL08 BBM08 BBN08 BBO08 BBP08 BBQ15 BBR08 BBS08	9 members BBA43 is the most distant paralog of this family
108 family	BBL09 BBM09 BBN09 BBO09 BBP09 BBQ16* BBR09 BBS09	8 members
109 family	BBL23 BBM23 BBN23 BBO23 BBP23 BBQ30 BBR23 BBS23	8 members
‡110 family	BB0079 BB0081	2 members
111 family	BBL24 BBM24 BBN24 BBO24 BBP24 BBQ31 BBR24 BBS24	8 members
112 family	BBL25 BBM25 BBN25 BBO25 BBP25 BBQ32 BBR25 BBS25	8 members
113 family	BBL28LP BBM28LP BBN28LP BBO28LP BBP28LP BBQ35LP BBR28LP BBS30LP	8 members cp32 mlp genes
114 family	BBL41 BBN41 BBO42 BBP40 BBQ48 BBR43	7 members
115 family	BBL42 BBM41 BBN42 BBO43 BBP41 BBQ49 BBR44 BBS44	8 members
116 family	BBN40 BBO41	2 members
117 family	BBG19 †BBQ61 BBQ63*	2 members
‡118 family	BB0098 BB0797	2 members
‡119 family	BB0136 BB0718	2 members
‡120 family	BB0147 BB0182	2 members
‡121 family	BB0172 BB0173	2 members
‡122 family	BB0179 BB0508 BB0643	3 members
‡123 family	BB0058 BB0195	2 members
‡124 family	BB0225 BB0737	2 members
‡125 family	BB0231 BB0245 BB0538	3 members
‡126 family	BB0251 BB0587	2 members
‡127 family	BB0295 BB0612	2 members
‡128 family	BB0304 BB0817	2 members
‡129 family	BB0316 BB0317	2 members
‡130 family	BB0678 BB0679	2 members
‡131 family	BB0366 BB0627	2 members
‡132 family	BB0415 BB0568	2 members
‡133 family	BB0471 BB0505	2 members
‡134 family	BB0567 BB0669	2 members
‡135 family	BB0638 BB0637	2 members
‡136 family	BB0652 BB0653	2 members
137 family	BB0734 BBT06 BBU08* BBU11	4 members
138 family	BB0852 BBJ21.1* †BBQ68 BBQ69*	3 members
139 family	BBA08 BBL19 BBM19 BBN19 BBO19 BBP19 BBQ26 BBR19 BBS19	9 members
140 family	BBA09 BBL20 BBM20 BBN20* BBO20 BBP20 BBQ27 BBR20 BBS20	9 members
141 family	BBA10 BBL21 BBM21 BBN21* BBO21 BBP21 BBQ28 BBR21 BBS21	9 members
142 family	BBA11 BBL22 BBM22 BBN22 BBO22 BBP22 BBQ29 BBR22 BBS22	9 members
143 family	BBA14LP BBG25LP BBL26LP? BBM26LP? BBN26LP? BBO26LP? BBP26LP? BBQ33LP? BBR26LP? BBS26LP?	10 members only BBA14 and BBG25 have lipidation consensus; others are one off from the current consensus (see section III below) - they are the most distant members of the family; Porcella et al. (1996) showed that a homolog (from strain 297) of the cp32 members of this family is not lipidated in E. coli.
144 family	BBA23 BBL37 BBM36 BBN36 BBO37 BBP36 BBQ44 BBR37 BBS39	9 members Previously called ORF-10 (Dunn et al., 1994; Zuckert and Meyer, 1996). BBG27 is a weak paralog of family 144
145 family	BBA31 BBL43 BBM42 BBN43 BBO44 BBP42 BBQ50 BBR45 BBS45	9 members phage fO1205 Orf26 homology; Orf26 is a possible phage structural protein
146 family	BBA38 BBL01 BBM01 BBN01 BBO01 BBP01 BBQ51* BBR01 BBS01	9 members
147 family	BBA39 BBL02 BBM02 BBN02 BBO02 BBP02 BBQ52 BBR02 BBS02	9 members
148 family	BBA40 BBL03 BBL04 BBL05 BBM03 BBM04 BBM05 BBN03 BBN04 BBN05* BBO03 BBO04 BBO05 BBP03 BBP04 BBP05 BBQ11* BBQ12 BBQ53 BBQ54* BBR03 BBR04 BBR05 BBS03 BBS04 BBS05	26 members There are three subfamilies in 148; each subfamily has one member from each cp32; the three subfamily genes lie in a contiguous cluster on each cp32.
149 family	BBA41 BBL06 BBM06 BBN06* BBO06 BBP06 BBQ13 BBR06 BBS06	9 members
150 family	BBA42 BBL07 BBM07 BBN07 BBO07 BBP07 BBQ14 BBR07 BBS07	9 members
151 family	BBA45 BBL10 BBM10 BBN10 BBO10 BBP10 BBQ17 BBR10 BBS10	9 members
152 family	BBA46 BBL11 BBM11 BBN11 BBO11 BBP11 BBQ18 BBR11 BBS11	9 members
153 family	BBA47 BBL12 BBM12 BBN12 BBO12 BBP12 BBQ19 BBR12 BBS12	9 members
154 family	BBA48 BBL13 BBM13 BBN13* BBO13 BBP13 BBQ20 BBR13 BBS13	9 members
155 family	BBA49 BBL14 BBM14 BBN14 BBO14 BBP14 BBQ21 BBR14 BBS14	9 members
156 family	BBL15 BBM15 BBN15 BBO15 BBP15 BBQ22 BBR15 BBS15	9 members
157 family	BBA51 BBL16 BBN16* BBM16 BBO16 BBP16 BBQ23 BBR16 BBS16	9 members BBN16 authentic frameshift
158 family	BBA53 BBA54	2 members
159 family	BBA55 BBL17 BBM17 BBN17 BBO17 BBP17 BBQ24 BBR17 BBS17	9 members
160 family	BBA56 BBL18 BBM18 BBN18* BBO18 BBP18 BBQ25 BBR18 BBS18	9 members
161 family	BBC05 BBL29 BBM29 BBN29* BBO29 BBP29 BBQ37 BBR29 BBR41* BBS31	10 members Previously called ORF-4 (Dunn et al., 1994; Zuckert and Meyer, 1996). BBR41* is a fusion of family 161 and 162 genes.
162 family	BBL39LP BBN38LP BBP38LP BBR40LP BBR41	5 members erp genes; BBR41* is an apparent fusion of family 161 and 162 genes.
163 family	BBF01LP? BBL40LP BBN39LP BBO40LP BBP39LP BBQ47LP	6 members erp genes; BBF01 has small patch of similarity to this gene family and an N-terminal sequence that is one off from our "stringent consensus" lipidation sequence.
164 family	BBM38LP BBO39LP BBR42LP BBS41LP	4 members erp genes
165 family	BBC12 BBL36 BBM35 BBN35 BBO36 BBP35 BBQ43 BBR36 BBS38	9 members Previously called ORF-8/7 (Dunn et al., 1994; Zuckert and Meyer, 1996).
166 family	(BB0845.11*) BBD001LP BBH01LP BBQ89LP	4 members; Could well all be pseudogenes since they are in highly recombined telomeric regions (Casjens et al., 2000). BB0845.11 is a possible pseudogene; this is a poor homolog and is not included in the TIGR master gene list
167 family	BBE29* BBQ67() BBJ20	3 members; The N-terminal portion of BBQ67 is paralogous to BBE29 and its C-terminal portion is similar to BBG02 (family 102); The N-terminal region of BBQ67 is a good match to the full length of an adenine methylase and could be functional in spite of this apparent fusion to BBG02-like sequences? BBJ20 is similar to the N-terminal portion of BBQ67 but not BBE29.
168 family	BBI30 BBQ75*	2 members
170 family	BBF32* vlsELP BBJ51*	3 members; BBF32 contains 15 tandem, direct repeats of vlsE-like sequences (in effect it is 15 pseudogenes, even though they are in-frame with one another); The vlsE gene is the only known B31 gene that is absent from TIGR sequence; this is due to its terminal location on lp28-1 and the presence of an unclonable sequence near it - see Zhang et al. (1997) and Casjens et al., 1999).
171 family	BBA74 BBH20* (BBJ11.1*)	3 members - A74 is osm28 of Skare et al. (1996) BBJ11.1 similarity to BBA74 is short and not strong - it is not in the TIGR computer’s master gene list
172 family	BBI02.1* BBU03	2 members
173 family	BBJ32 BBJ45.1*	2 members
174 family	BBK52.1* BBQ02	2 members
175 family	BBD15.01* BBF19.1* BBK37*	3 members BBK37 is a fusion gene that also contains sequences similar to family 75 members; although BBK37 is truncated relative to intact family 75 members it appears that it might be expressed.

Part III

(v) List of sequences of N-terminal 60 amino acids of the consensus and near-consensus lipoprotein genes on B31 plasmids

Most authors use an "N-terminal lipidation consensus sequence" in which the proteins must

(iv) contain the following consensus relative to the above Cys (defined as position +1)

We refer to this as the "stringent consensus" in the following discussion (for Gram positive bacterial consensus, see Sutcliffe and Russell, 1995).

B31 proteins that contain this consensus that may be most likely to be lipoproteins in reality, but lipoprotein gene identification in this way is not completely certain, especially in Borrelia, and so the following analysis should be understood to be a current best guess, and NOT as the final word in the identification of Borrelia burgdorferi B31 lipoprotein encoding genes.

Interestingly, the sequence "LTXIC" is present in conjunction with a decent signal sequence in A68, A69, I36, I38, I39 and J41. These genes are all in paralogous family [54], which contains a number of other consensus lipoprotein genes; could this mean that this "non-consensus" sequence is actually lipidated? Similarly the erpL gene (BBO39) has an M at position -3 but is likely to be a lipoprotein, since it is a member of a family of genes in which all other members have the above "stringent" lipidation consensus. Perhaps a better(?) "relaxed consensus" for potential Borrelia lipoproteins can be guessed at from "near-consensus" genes which are known surface proteins or which fall into paralogous families with "consensus gene" members. Most proteins of this type have conservative differences from the above consensus - in particular, S, G or M in position -4, T or M in position -3, and I, T or L in position -1; these could be included in a "relaxed consensus". In part because of these uncertainties, an analysis (described below) that was more complex than a simple consensus search was performed on all of the putative B31 encoded proteins in order to identify the potential lipoproteins.

Putative B31 proteins were included in the predicted lipoprotein list by the following procedure:

1. A preliminary B31 potential lipoprotein list was generated by rules derived from other species (positive charge near N-terminus followed by a hydrophobic stretch of amino acids that is in turn followed immediately by a lipidation consensus).

2. This list was then manually curated using the Borrelia lipoprotein literature and by inspection of the N-terminal sequences. At this point a few genes were added and or removed. Nearly all of the remaining proteins met the "stringent" consensus (above) and the remaining few met a somewhat more relaxed consensus with only conservative amino acid additions.

3. This list was then used to build a multiple sequence alignment of the putative lipoprotein N-terminal regions that included the presumptive lipoprotein signal and some additional sequence. The alignment was edited, poorly aligned sequences removed, and the alignment was trimmed at the N-terminus to include Met-1 of most but not all sequences, and at the C-terminus to include the predicted modified Cys residue and 4 residues beyond it (the analysis showed that these last 4 residues had little effect on the final results).

4. From this alignment, a Hidden Markov Model (HMM) for the N-terminal region of lipoproteins was constructed using the HMMER 1.8.4 package.

5. The HMM analysis provided a set of all B31 proteins with potential lipidation sequences, listed according to descending HMM score. This list was used in a final manual curation of the potential lipoprotein list as follows:

(i) Any high-scoring genes (HMM scores >25 with a lipidation consensus at position ²40) that were previously missed were added to the list.

(ii) In some cases new start codon assignment allowed high scoring genes to be added to the list.

(iii) Genes that are members of "lipoprotein families" were added if their HMM score was >19.5. The HMM scores dropped off rather quickly; only 16 plasmid proteins not in the final potential lipoprotein list have the sequence N-terminal positive charge and hydrophobic signal sequence features required and HMM scores above 11.

6. The resulting "Potential B31 Lipoprotein List" includes 141 genes given below.

The HMM analysis also identified a number of additional proteins that have N-terminal regions that are similar to those predicted to be lipoproteins, but which do not quite meet the above criteria. We conclude that there may be as many as 20-50 lipoproteins in Borrelia beyond those we specifically predicted.

Note: Bona fide type I signal sequences on non-lipidated proteins share some of the above characteristics, including basic residues near the N-terminus followed by a hydrophobic region. Lipoproteins differ in having the modified Cys itself and the lipidation consensus region. The HMM model was not specifically designed to discriminate between type I and lipidated signal sequences, so many of the weakly predicted lipoproteins are likely to be membrane proteins even if they are not in fact lipidated.

136 putative B31 genes encode proteins that are the most likely to be lipoproteins.

38 of these putative lipoproteins are chromosomally encoded (all by "intact" genes).

7 putative plasmid encoded lipoproteins (BBF20, BBF32, BBI14, BBJ001[BBJ01], BBK01, BBQ04, BBR40) come from ORFs currently classified as pseudogenes that may have intact translation starts with the lipidation consensus sequence.

1 putative plasmid lipoprotein (BBI32) is translated from "questionable" genes (see discussion of these above).

9 paralogous gene families (families 36, 53, 63, 74, 85, 113, 164, 166, 170) encode only predicted lipoproteins, and several others (e.g., family 12) contain genes that encode only with a near-consensus lipidation sequence.

17 paralogous gene families (families 12, 21, 37, 40, 44, 52, 54, 59, 60, 69, 75, 92, 102, 136, 143, 162, 163) are heterogeneous in that at least 1 potential LP and at least one non-LP is found in the family. A substantial fraction of the proteins from these families that are not predicted to be lipidated by the above protocol have "near-consensus" sequences, suggesting that they might in fact also be lipoproteins.

BB0028, BB0038, BB0071, BB0141, BB0144, BB0155, BB0213, BB0215, BB0224, BB0227, BB0298, BB0321, BB0324, BB0352, BB0328, BB0365, BB0382, BB0383, BB0384, BB0385, BB0398, BB0458, BB0464, BB0475, BB0536, BB0542, BB0553, BB0620, BB0628, BB0652, BB0664, BB0689, BB0758, BB0806, BB0823, BB0832, BB0840, BB0844

The 98 plasmid genes and pseudogenes that are potential lipoproteins are as follows:

(* indicates ORFs currently classified as pseudogenes; † indicates "questionable" gene calls; # pseudogenes not listed as LPs on the TIGR WEB site for technical reasons):

BBA04, BBA05, BBA07, BBA14, BBA15, BBA16, BBA24, BBA25, BBA33, BBA34, BBA36, BBA57, BBA59, BBA60, BBA62, BBA64, BBA65, BBA66, BBA68, BBA69, BBA73, BBB08, BBB09, BBB14, BBB16, BBB19, BBB25, BBB27, BBC10, BBD001, BBD10, BBD15, BBE06, BBE08, BBE09, BBE31, BBF20*, BBF32*, vlsE#, BBG01, BBG02, BBG25, BBH01, BBH18, BBH32, BBH37, BBI14*, BBI16, BBI28, BBI29, BBI32†, BBI34, BBI36, BBI38, BBI39, BBI42, BBJ001#*(BBJ01*†), BBJ09, BBJ34, BBJ36, BBJ41, BBK01*, BBK07, BBK12, BBK19, BBK47, BBK48, BBK49, BBK50, BBK52, BBK53, BBL28, BBL39, BBL40, BBM27, BBM28, BBM38, BBN28, BBN38, BBN39, BBO28, BBO39, BBO40, BBP27, BBP28, BBP38, BBP39, BBQ03, BBQ04*, BBQ05, BBQ35, BBQ47, BBQ89, BBR28, BBR40*, BBR42, BBS30, BBS41

The following is a list of the scores of the potential lippoprotein gene products obtained from the HMM analysis (see above; Dan Haft, unpublished). These scores were taken into account but were not the sole criteria for inclusion of genes as potential lipoprotein encoding genes.

GENE/aa	HMM SCORE	PREDICTED N-TERMINAL AA SEQUENCE

BBR40/1-24	36.67	MNKKMKNLIICAVFVLIISCKNNT
BBS41/1-24	36.54	MNKKMKNLIICAVFVLIISCKIDA
BBR42/1-24	36.17	MNKKIKMFIICAIFMLISSCKNDV
BBK52/1-24	35.38	MKKNIYILNIFLYIPLFYSCFLTP
BBQ47/1-24	35.27	MNKKMKIFIICAVFVLISSCKIDA
BBM28/1-22	34.68	MKIINIL--FCLFLLLLNSCNSND
BBP28/1-22	34.68	MKIINIL--FCLFLLLLNSCNSND
BBQ35/1-22	33.69	MKIINIL--FCISLLLLNSCNSND
BBC10/1-26	33.66	MQKINIAKLIFILIFSLFVISCELFI
BB0664/12-35	33.62	MNINTLFYGMIIIIFALISCNHKN
BBN28/1-22	33.44	MKIINIL--FCLFLLMLNSCNSND
BBO39/1-24	33.34	MNKKMKMFIICAVFALMISCKNYA
BBB08/1-22	32.71	MKKKFNF--IFPFIIFLFSCNISV
BBJ09/1-24	32.58	MKKLIKILLLSLFLLLSISCVHDK
BBA14/1-24	32.51	MQIKNFPFLFLLNSLIIFSCSTIA
BBL39/5-28	32.12	MNKKMKMFIICAVFILIGACKIHT
BBP38/1-24	32.12	MNKKMKMFIICAVFILIGACKIHT
BB0398/1-24	31.93	MNLLVKIAKFILILFLFTSCNQKQ
BBO40/1-22	31.65	MNKKILI--IFAVFALIISCKNYA
BBM27/1-24	31.33	MRNKNIFKLFFASMLFVMACKAYV
BBL28/1-22	30.97	MKIINIL--FCLFLLMLNGCNSND
BBO28/1-22	30.97	MKIINIL--FCLFLLMLNGCNSND
BBR28/1-22	30.97	MKIINIL--FCLFLLMLNGCNSND
BBS30/1-22	30.97	MKIINIL--FCLFLLMLNGCNSND
BBK48/1-24	30.91	MNLINKLFILTILFSSVISCKLYK
BBB16/1-26	30.43	MKILIKKLKVVLFLNLILLISCVNES
BBB19/1-23	30.38	MKKNTLSAI-LMTLFLFISCNNSG
BBE09/1-24	30.32	MQKDIYISNIFLYIPLFYSCFLTP
BBM38/5-26	30.32	MNKKMFI--ICAIFALIVSCKNYA
BBP27/1-24	30.23	MRNKNIFKLFFAAMLFVMACKAYV
BBI14/1-22	29.88	MKNKIIL--CMCVFSLLNSCNFDN
BBA65/1-24	29.85	MNKIKLSILITLGITTFFSCDLNN
BBK19/1-21	29.73	MKKYIIN---LSLCLLLLSCNLFS
BBD15/1-26	29.66	MNRKFVISLLFIILTFLLILGCDLSI
BBJ36/1-24	29.59	MKRKSNICISLLVTILFVSCKFFG
BBE31/1-22	29.58	MKYHIIV--SIFIFLFLNACNPDS
BBA07/1-24	29.55	MCGRRMKNILLFVILLFFSCKEFN
BBG25/1-27	29.44	MKNLKTKINFLGIFWLLLLFLSCESIP
BBN38/1-24	29.36	MNKKMKMFIVCAVFILIGACKIHT
BBD001/1-19	29.08	MNKL-----LIFIILLVFSCNLSN
BBH01/1-19	29.08	MNKL-----LIFIILLVFSCNLSN
BBQ89/1-19	29.08	MNKL-----LIFIILLVFSCNLSN
BB0155/1-23	28.94	MKKHYKALI-LSLLFAIISCNTKT
BBA69/6-29	28.90	LNIIKINIITMILTLICISCAPFN
BBK50/1-24	28.89	MNLIIKVMLISSLFSSFISCKLYE
BBJ01/1-22	28.70	MKYHIIV--SIFVFLFLNACNPDS
BBA73/1-25	28.62	MKRNKIWKTLKLFQITLLFSCSFYS
BBL40/1-22	28.55	MNKKTII--ICAVFALILSCKNYA
BBP39/1-22	28.55	MNKKTII--ICAVFALILSCKNYA
BBA59/1-21	28.15	MVKKII---FISFSIFIVSCSAIG
BBD10/1-23	28.14	MNSKFILK-YFILAFFLVSCQTYQ
BB0844/1-23	28.03	MKKKNLSI-YMIMLISLLSCNTSD
BB0365/1-26	27.84	MYKNGFFKNYLSLFLIFLVIACTSKD
BB0840/1-25	27.76	MKNINRLILLILTTHTLLFSCALIA
BBI29/1-22	27.73	MKNNIIL--CMCVFLLLNSCTANH
BB0806/1-26	27.55	MKFVLNNLFKGCLICFFLFFSCLTTD
BBN39/1-22	27.47	MNKKTLI--ICAVFALIISCKNFA
BB0328/1-22	27.39	MKYIKIA--LMLIIFSLIACISNA
BBA05/1-22	27.28	MNKIGIA--FIISFLLFVNCKGKS
BB0385/1-21	26.57	MLKKVY---YFLIFLFIVACSSSD
BBH32/1-22	26.56	MKYNTII--SIFVCLFLTACNPDF
BBE08/1-21	26.49	MQKNVY---CFIIFVLISSCNNYA
BB0141/2-30	26.48	MNLIFNINLYLKKYFLVLFLVLVACVGDN
BBH37/1-22	26.46	MKKKMFL--YTLLTIGLMSCNLNS
BBF20/1-26	26.35	MNKKFSISLLSTILAFLLVLGCDLSS
BB0352/1-26	26.27	MNNFMRIKNLILIAILLISPSCSTNK
BB0536/1-27	26.26	MNYQRIKNYCKFTSVFLFFLFSCVSNE
BB0383/1-22	25.89	MNKILLL--ILLESIVFLSCSGKG
BB0324/1-18	25.77	MKK------LILLNLIFISCYTIN
BB0652/1-22	25.61	MKKGSKL--ILILLVTFFACLLIF
BBA57/1-27	25.60	MNGKLRKALKIAIFTTLLLVISCNANM
BBA60/1-21	25.22	MSKKVI---LILLEILILSCDLSI
BB0215/1-24	25.14	MMKKVIILIFMLSTSLLYNCKNQD
BBA33/1-21	24.90	MKRYIY---VYIISVAVISCYLND
BBA68/6-29	24.71	LNIIKINIIAMILTLICTSCAPFS
BBK12/1-20	24.64	MSKLI----LAISILLIISCKWYV
BBK47/6-29	24.44	IKIFIIPNLVFSSLFLFESCSGFL
BBK49/6-29	24.44	IKIFIIPNLVFSSLFLFESCSGFL
BBJ34/1-23	24.32	MIKGNTFI-LILVTTMFVSCKFYG
BB0628/1-21	24.21	MRKCFV---SLSLLLIFFACSSNV
BBE06/1-21	23.97	MRFLNI---IKSLEFFVMSCNDIF
BB0028/6-29	23.83	ENYFKKRLILNLLIFLLLACSSES
BBA64/6-32	23.81	LKNNKLIAIFLLHVLTVLILISCSLEV
BBB09/1-20	23.76	MKYLKN----ISLFLLILGCKSIP
BBB14/2-26	23.7	ILYQNQLKFLKLLVFFLLISCTSLN
BB0224/3-26	23.4	GRKDLFFLILFLSFSIIISCRVKG
BBK07/1-20	23.4	MSKLI----LAISILLIISCKWHV
BBQ05/1-20	23.35	MKYYI----CVCVFLLLNACNSDF
BBA66/1-23	23.24	MKIKPLIQ-LKLLGLFLFSCTIDA
BBI28/1-21	23.22	MKCHIIA---TIFVFLFLACSTDF
BBI16/1-21	23.19	MKYHII---TTIFVFLFLACRPDF
BB0689/1-20	22.97	MKKLI----IIFTLFLSQACNLST
BBA25/1-25	22.81	MKIGKLNSIVIALFFKLLVACSIGL
BB0542/12-35	22.79	DLSKFFMYKLLFIIVFVLSCSSIF
BBB27/1-20	22.66	MKKFL----ISVYFLLFYGCSTIS
BB0823/1-20	22.36	MNTKT----LYLISLILLACNKNN
BBI34/1-22	22.36	MKHYIIV--HIFVFLFLNACYPVA
BBB25/1-21	22.29	MKYCFS---LILMVFICSSCKILN
BB0298/1-20	21.70	MKILW----LIILVNLFLSCGNES
BBA62/1-22	21.51	MTKLMYA--IFLSAILFVACETTR
BBA15/1-21	21.43	MKKYLLG---IGLILALIACKQNV
BB0144/1-20	21.38	MYKLF----LFFIIFMFLSCDEKK
BB0384/1-21	21.35	MFKRFI---FITLSLLVFACFKSN
BB0758/10-36	21.32	LKLLRQSINLKSLFPLSVLFFSCNVVD
BB0038/18-41	21.17	ELIPFYKFLFLFFFFTLLACSKVS
BB0620/1-20	21.03	MKRNFY----LIVLFIANNCFSID
BB0321/5-29	20.81	MVYSLKIQIEEEINIFVFISCLKLL
BB0382/1-19	20.76	MRIV-----IFIFGILLTSCFSRN
BBA36/1-21	20.70	MMQRIS---ILLMLLAVFSCKQFG
BBJ41/1-29	20.45	MKNLKLNIIKLNVITAILTSICISCAPFG
BB0464/1-19	20.42	MKILR-----LCLLFLFFACTFDY
BB0475/7-31	20.35	FKLKLLPILVISGILIVFMSCMKTS
BBG02/1-27	20.16	MEINLQSKLNNKNNNKLIFFISCSLVL
BB0553/1-21	20.07	MNKTKNR---SLTYFIILSCISLF
BBI39/1-29	19.84	MKNFKLNIIKLNVITAILTSICISCAPFG
BB0213/1-22	19.76	MQSGLKI--KLILFFCCFACSCDI
BBI36/1-29	19.62	MKNFKLNTIKLNVITAILTLICISCAPFG
BBI38/1-29	19.62	MKNFKLNTIKLNVITAILTLICISCAPFG
BBG01/1-22	19.51	MRKSLFL--YTLLMGGLMSCNLDS
BB0227/1-27	19.50	MLNPRTIKTTFMLISTLMIFNGCTKKL
BBA24/5-29	19.22	NNKTFNNLLKLTILVNLLISCGLTG
BB0071/1-24	19.19	MVRFLGFLYLITTIPLIKSCDAAQ
BBA34/1-23	19.11	MIIKKRGL-LILGIATVISCSAMS
BBA04/1-19	19.06	MKRV-----IVSFVVLILGCNLDD
BBK01/1-22	18.94	MRKSLFL--YALLMGGLMSCNLDS
BBH18/6-29	17.94	KRVGNKIFYISVVLILIVGCDWGT
BBI32/3-29	17.61	LNFRVIFLISHTQYMYSPILKSCEFIN
BB0832/1-22	17.38	MLKTLTK--IITISCLIVGCASLP
BB0458/16-39	17.09	KRSKMRLILMLLLXFLCFSTLLSQ
BBQ03/1-22	16.09	MRILVGV--FIIAALALLGCYLPD
BBK53/1-22	14.77	MRILVGV--CIIAALALLGCYLPD
BBI42/1-21	14.70	MRILVG---VCIIALALLGCYLPD
BBA16/1-20	13.07	MRLLIG----FALALALIGCAQKG

———————————————————————————————————————————————————————————————

make it into the list of potential lipoprotein genes. Some of them could in fact

———————————————————————————————————————————————————————————————

BBK45/26-48	24.00	MNLMIKVLI..........FSLFLSFISCKLYE
BB0460/1-21	18.27	MKTRII............IFLSILSILSCSKSV
BBK32/1-24	18.13	MKKVKSKYL.........ALGLLFGFISCDLFI
BBQ46/1-17	17.71	MIKNVIYILp kt...kkFSQIVWLLIACKIWI
BB0323/1-25	17.40	MNIKNKLISl........LIVVAISFIACKTPP
BB0171/1-25	17.30	MGRNFLAILy........FCFLFLGFLSCSNVK
BB0329/1-23	16.13	MKLQRSLF..........LIIFFLTFLCCNNKE
BB0259/16-48	15.96	MKKINMFNRsscvlqnflFLFLFLSLVSCFAKK
BB0330/7-32	15.60	KKIGKKIKIv.......tLLMLAVSLIACNNNS
BBB24/18-41	15.59	LKIFKKYLL.........LFYLLFLTLSCSTIY
BBA32/1-20	15.14	MRITG.............LLFFLICLLSCSSFN
BB0639/1-20	14.81	MKKIF.............ILIVILTTFACTNKD
BBA03/1-21	13.90	MKKTII............VFIILAFMLNCKNKS
BBH06/1-23	12.76	MKKSFLSI..........YMLISISLLSCDVSR
BBS26/1-22	12.19	MKMLKRL...........HCLLIVLLLCCTTIA
BBP26/1-22	12.19	MKMLKRL...........HCLLIVLLLCCTTIA
BBO26/1-22	12.19	MKMLKRL...........HCLLIVLLLCCTTIA
BBL26/1-22	12.19	MKMLKRL...........HCLLIVLLLCCTTIA
BBR26/1-22	10.70	MKMLKRL...........HCLLIALLLCCTTIA
BBQ33/1-22	10.70	MKMLKRL...........HCLLIALLLCCTTIA
BBN26/1-22	10.70	MKMLKRL...........HCLLIALLLCCTTIA
BBM26/1-22	10.70	MKMLKRL...........HCLLIALLLCCTTIA
BB0560/1-23	10.68	MILIFYFK..........QIALFIIFRLCYIIK
BB0729/7-30	10.60	LYTLINIII.........MLILISIVYLCKRKN
BB0305/1-28	10.31	MNSISKIEFkv.....ycILVLILTVILCFNIY
BB0332/1-27	10.22	MLKFTLKKIlg......iIPTLLVIIFLCFFVM
BB0204/1-26	16.01	MKFIINLLLs.......tIKIITFTVIVCLTIL
BB0752/1-27	12.73	MKNKENEVLnl......tLNLTIIFLIFCNISI
BBF01/1-23	12.48	MKLLKIFM..........CAFLLLNLVNCKFDS
BB0315/1-22	11.64	MRKITIM...........ILFYGLIINVCPTTT
BB0353/1-21	11.45	MKREIYA............FLSNFIIFMCFFLG
BBJ47/5-28	11.16	SNCIKYIIL.........TMLIGLLIFCCATFV

2. BB gene names are the open reading frames identified in the nucleotide sequence of the genome of isolate B31.

* Putative pseudogenes may not always be included in this table, but when they are they are indicated by an asterisk.

# Have a "near-cutoff" lipidation signal, but was not included in our list of potential lipoproteins.

3. vlsE, the rightmost gene on lp28-1 is not in the reported genomic sequence, apparently due to an unclonable sequence nearby (Zhang et al., 1997).

4. Reference to the complete B31 genome sequence (Casjens et al., 1999; Fraser et al., 1997) are not given in the table. Sequences from Borrelia isolates other than B31 are indicated in French brackets {....}.

Common gene name1	BB gene name2	Paralog Family	Location	Comments	References4
7.5 kd lipoprotein	BBA62	—	lp54	transcription start (Indest et al., 1997) also called 6.6 kbp lipoprotein	possible surface exposure (Katona et al., 1992; Lahdenne et al., 1997) {297}
12 Kda lipoprotein	BBA59	—	lp54		short gene but it is expressed; (McGrath et al., 1997)
mlpA mlpC mlpD mlpF mlpG mlpH mlpI mlpJ	BBP28 BBS30 BBR28 BBM28 BBO28 BBL28 BBN28 BBQ35	113	cp32-1 cp32-3 cp32-4 cp32-6 cp32-7 cp32-8 cp32-9 lp56	also called "LP" and "nlpH"	(Gilmore and Mbow, 1998; Porcella et al., 1996) {297}; lipidated in E. coli (Porcella et al., 1996); lipidated in B. afzelii DK1 (Theisen, 1996) {297, DK1}
dbpA dbpB	BBA25 BBA26	74	lp54	binds decorin	surface exposed on outer membrane; binds decorin (Guo et al., 1998; Hagman et al., 1998; Hanson et al., 1998){N40}
erpA & B erpG erpH & Y erpK erpL & M erpN & O erpP & Q erpX	BBP38, P39 BBS41 BBR40*, R42 BBM38 BBO39#, O40 BBL39, L40 BBN38, N39 BBQ47	162, 163 and 164	cp32-1 cp32-3 cp32-4 cp32-6 cp32-7 cp32-8 cp32-9 lp56	these genes fall into at least 3 paralogous classes [162,163,164] (Akins et al., 1999; Casjens et al., 1999; Stevenson et al., 1998b) also called "p21" and "ospE & ospF"	surface exposed (Lam et al., 1994){N40}; lipidated in E. coli (Akins et al., 1995b; Wallich et al., 1995); erp-like genes have been sequenced from several strains (Akins et al., 1999; Lam et al., 1994; Marconi et al., 1996b; Stevenson et al., 1997; Stevenson et al., 1996; Suk et al., 1995){297, ZS7, N40}
fibronectin binding protein	BBK32#	—	lp36	fibronectin binding; called P35 in strain N40; upregulated in stationary phase in N40 (Fikrig et al., 1997; Indest et al., 1997)	one off from "stringent lipidation consensus" (G in position 1); surface localized (Probert and Johnson, 1998)
oppAIV oppAV	BBA34 BBB16	37	cp26 lp54	ABC oligopeptide transporter	B16 not surface exposed; not essential in culture (Bono et al., 1998)
ospA ospB	BBA15 BBA16	53	lp54 lp54	transcription start site (Jonsson et al., 1992); OspA atomic resolution structure (Li et al., 1997); in vitro mutagenesis (McGrath et al., 1995)	outer surface protein (Barbour et al., 1983); lipidated in Bb; (Bergstrom et al., 1989; Brandt et al., 1990); ; sequenced in numerous other strains (Bunikis et al., 1996; Caporale and Kocher, 1994; Jonsson et al., 1992; Marconi et al., 1993a; Rosa et al., 1992; Wallich et al., 1992; Wallich et al., 1989; Wang et al., 1997a; Wang et al., 1997b; Wang et al., 1997c; Will et al., 1995; Wilske et al., 1996a; Wilske et al., 1996b; Wilske et al., 1992; Zumstein et al., 1992)
ospC	BBB19	—	cp26	temperature regulated (Schwan et al., 1995; Stevenson et al., 1995) transcription start site (Marconi et al., 1993b)	surface localized (Wilske et al., 1993); sequenced in {many strains} (e.g., Fuchs et al., 1992; Jauris-Heipke et al., 1993; Jauris-Heipke et al., 1995; Marconi et al., 1993c; Margolis et al., 1994a; Margolis et al., 1994b; Masuzawa et al., 1997; Stevenson and Barthold, 1994; Stevenson et al., 1994; Tilly et al., 1997; Wang et al., 1999; Wilske et al., 1996a; Wilske et al., 1996b)
ospD	BBJ09	—	lp38	short direct repeat upstream of gene	outer surface protein (Marconi et al., 1994; Norris et al., 1992){many strains}
P27	BBA60	—	lp54		(Reindl et al., 1993) {B29}
P35 antigen	BBA64 BBA65 BBA66 BBA68 BBA69 BBA70† BBA71† BBA73 BBI36 BBI38 BBI39 BBJ41	54	lp54 lp54 lp54 lp54 lp54 lp54 lp54 lp28-4 lp28-4 lp28-4 lp38	BBA64 cell density-dependent expression and transcription start (Indest et al., 1997)	(Gilmore et al., 1997)
rev	BBP27 BBC10 BBM27	63	cp32-1 cp9 cp32-4		(Gilmore and Mbow, 1998; Porcella et al., 1996)
S1	BBA05	—	lp54		(Feng et al., 1995){N40}
S2	BBA04 BBE09 BBK04* BBK52 BBQ04*	44	lp54 lp25 lp36 lp36 lp56		(Feng et al., 1995){N40}
vlsE7	vlsE BBF32* BBJ52*†	170	lp28-1 lp28-1 lp36	F32 is 15 tandem unexpressed versions of part of the vlsE gene	cassette surface antigenicity variation mechanism (Zhang et al., 1997; Zhang and Norris, 1998a; Zhang and Norris, 1998b)
Below are plasmid open reading frames with LP "stringent" consensus that have not been previously given common names
	BBA07	—	lp54
	BBA14 BBG25	143	lp54 lp28-2	other cp32 members of family do not have lipidation consensus
	BBA33	—	lp54
	BBA36	—	lp54
	BBA57	—	lp54
	BBB08	—	cp26
	BBB09	—	cp26
	BBB14	—	cp26
	BBB25	—	cp26
	BBB27	—	cp26
	BBE31 BBH32 BBI14* BBI16 BBI28 BBI29 BBI34 BBJ001* BBK15# BBQ05	60	lp25 lp28-2 lp28-4 lp28-4 lp28-4 lp28-4 lp28-4 lp38 lp36 lp56
	BBD001 BBH01 BBQ89	166	lp17 lp28-3 lp56	²300 bp ²300 bp ²300 bp
	BBD10	—	lp17
	BBD15 BBF20*	85	lp17 lp28-1
	BBE06	—	lp25	²300 bp
	BBE08	—	lp25	²300 bp
	BBG01 BBH37 BBK01* BBJ08† BB0844	12	lp28-2 lp28-3 lp36 lp38 chrm
	BBG02	102	lp28-2
	BBI32	—	lp28-4	questionable gene
	BBJ34 BBJ36	92	lp38 lp38
	BBK07 BBK12	59	lp36 lp36
	BBK19	—	lp36
	BBK45# BBK46*† BBK48 BBK50	75	lp36 lp36 lp36 lp36
	BBK47 BBK49 BBH18	69	lp36 lp36 lp28-3
	BBK53 BBI42 BBQ03	52	lp36 lp28-4 lp56

The table below shows the first 60 amino acids of all the B31 plasmid genes that contain a putative N-terminal lipidation consensus. It also includes those B31 plasmid genes that are not included in our "potential lipoprotein list" but which have an HMM score (above) of >11 as well as some added by manual inspection. If fewer than 60 amino acids are shown in the table below, the entire predicted amino acid sequence of that gene’s translation is shown.

* Asterisks mark the putative proteins which contain the following "stringent" consensus

† Non-stringent consensus proteins that we consider to be potential lipoproteins (see rules above)

# Indicates a below cut-off gene that might be worthwhile considering when dealing with the potential lipoprotein genes in this genome, since it is particularly close the above "stringent" consensus.

Underlined amino acids are non-stringent consensus amino acids within the consensus region.

Alternate, better(?) translation starts are double underlined in the following table.

C’s are red, positively charged K, R and H’s are blue and negatively charged D and E’s are green.

BBP26 # (one member of this family [from strain 297] was not lipidated in E. coli, Porcella et al., 1996)

BBP28 * (mlpA) (lipidated in E. coli, Porcella et al., 1996), (lipidated in Bb, Theisen, 1996)

BBP38 * (erpA) (Erp homologs surface exposed in other Bb strains and lipidated in E. coli, Akins et al., 1995b; Lam et al., 1994; Wallich et al., 1995)

BBS26 # (one member of this family [from strain 297] was not lipidated in E. coli, Porcella et al., 1996)

BBR26 # (one member of this family [from strain 297] was not lipidated in E. coli, Porcella et al., 1996)

BBM26 # (one member of this family [from strain 297] was not lipidated in E. coli, Porcella et al., 1996)

BBO26 # (one member of this family [from strain 297] was not lipidated in E. coli, Porcella et al., 1996)

BBL26 # (one member of this family [from strain 297] was not lipidated in E. coli, Porcella et al., 1996)

BBN26 # (one member of this family [from strain 297] was not lipidated in E. coli, Porcella et al., 1996)

BBK32 # (Fibronectin-binding protein, surface localized, Probert and Johnson, 1998)

BBA15 * (ospA) (lipidated and surface exposed, Barbour et al., 1983; Brandt et al., 1990)

BBA16 * (ospB) (lipidated and surface exposed, Barbour et al., 1983; Brandt et al., 1990)

BBA24 * (dbpB) (surface exposed, protein lipidated in E. coli, Hagman et al., 1998; Hanson et al., 1998)

BBA34 * (oppA IV) (not surface exposed/probably periplasmic, Bono et al., 1998)

BBA60 * (P27) (lipidated and surface exposed in strain B29, Reindl et al., 1993)

BBA62 * (7.5 kd) (lipidated, in outer membrane, possible surface exposure, Katona et al., 1992; Lahdenne et al., 1997)

BBQ33 # (one member of this family [from strain 297] was not lipidated in E. coli, Porcella et al., 1996)

Part IV

by Sherwood Casjens, Granger Sutton, Jeremy Peterson & Dan Haft - completed March 1999.

The purpose of the following table is to call attention to the B31 plasmid genes which may not have a biological function. It lists (i) all the putative pseudogenes, (ii) all those computer (GLIMMER)-recognized genes that are "questionable" for some reason, and (iii) all the short (<300 bp) genes on the B. burgdorferi B31 plasmids. The reason for categorizing each gene as a "questionable gene" or "pseudogene" is given in the "COMMENTS" column. It is of course very possible that any given "short" or "questionable" gene or truncated "pseudogene" could be expressed and could have a biological function. We do not mean to imply that this is anything beyond our best current guess at functionality

PSEUDOGENE - a region of DNA that is similar in sequence to a paralogous Borrelia gene or a gene from another organism, but which is truncated relative to other members of the gene family and/or does not have a full open reading frame.

QUESTIONABLE GENE - an ORF that is called a putative gene by the TIGR gene-recognition protocol, but may be a false recognition because it is either (i) within another gene or pseudogene, or (ii) was not called in highly similar, paralogous sequence elsewhere on the B31 plasmids.

† -"Daggers" in column 1 indicate computer-recognized open reading frames that are in-frame inside of larger pseudogenes (they are questionable gene calls that are part of a larger pseudogene).

SHORT GENE - a <300 bp long ORF that was recognized as a putative gene by the TIGR gene-recognition protocol that is NOT in the "questionable" or "pseudogene" categories.

Genes <300 bp are rather highly over-represented on some of the B31 the plasmids, so it is possible, or even perhaps likely, that some these are in fact not real genes, but are spurious gene calls in "junk DNA" on these plasmids. Such short genes are often not closely packed like the Borrelia chromosomal genes and most other prokaryotic genes. About 9% (80/844) of the putative Bb chromosomal genes are <300 bp (and some of these are homologs of small genes of known function, pointing out again that particular short plasmid genes may well have a function). The fraction of "short" genes is considerably higher on the B31 plasmids which contain putative decaying DNA regions.

A "*" in the SHORT GENE column of the table below indicates a <300 bp gene that is either a "questionable gene" or "pseudogene" and so does not fit into the "short gene" category as we define it.

GENE NAME	5’-end	3’-end	SHORT GENE	QUESTIONABLE GENE	PSEUDO- GENE	COMMENTS (paralogous family names in [square brackets])
cp9
BBC04	2700	2593	SHORT			no homolog outside of Borrelia
BBC07	4788	4507	SHORT			no homolog outside of Borrelia

cp26
BBB15	11636	11737	SHORT			no homolog outside of Borrelia
BBB20	17733	17626	SHORT			no homolog outside of Borrelia
BBB21	17750	17842	SHORT			no homolog outside of Borrelia

cp32-1
BBP14	8724	8957	SHORT			probably a real gene; has paralogs on other cp32s
BBP23	15215	15415	SHORT			probably a real gene; has paralogs on other cp32s

cp32-3
BBS14	8724	8957	SHORT			probably a real gene; has paralogs on other cp32s
BBS23	15212	15412	SHORT			probably a real gene; has paralogs on other cp32s
BBS28	16915	17046	SHORT			no homolog
BBS32	19198	19392	*	QUESTIONABLE		paralog not called in paralogous sequence elsewhere
BBS43	28067	28246	SHORT			no homolog

cp32-4
BBR02	1306	1998			PSEUDO	authentic frameshift
BBR14	8734	8967	SHORT			probably a real gene; has paralogs on other cp32s
BBR23	15167	15367	SHORT			probably a real gene; has paralogs on other cp32s
BBR30	18829	18737	*	QUESTIONABLE		paralog not called in paralogous sequence elsewhere
BBR35	21974	22357			PSEUDO	authentic point mutation
BBR39	25636	25538	*	QUESTIONABLE		paralog not called in paralogous sequence elsewhere
BBR40	25865	25966	*		PSEUDO	N-terminal erp gene [162] fragment (named erpH)
BBR41	26077	26817			PSEUDO	fusion of erp gene [162] and family [161] gene

cp32-6
BBM14	8734	8967	SHORT			probably a real gene; has paralogs on other cp32s
BBM23	15231	15431	SHORT			probably a real gene; has paralogs on other cp32s
BBM40	27731	27850	*	QUESTIONABLE		overlaps BBM39

cp32-7
BBO14	8726	8959	SHORT			probably a real gene; has paralogs on other cp32s
BBO23	15222	15422	SHORT			probably a real gene; has paralogs on other cp32s
BBO35	22755	22630	*	QUESTIONABLE		paralog not called in paralogous sequence elsewhere
BBO41	28117	28007	*	QUESTIONABLE		paralog not called in paralogous sequence elsewhere

cp32-8
BBL14	8724	8957	SHORT			probably a real gene; has paralogs on other cp32s
BBL23	15215	15415	SHORT			probably a real gene; has paralogs on other cp32s
BBL33	21467	21556	SHORT			no homolog

cp32-9
BBN05	3343	3950			PSEUDO	authentic frameshift
BBN06	3960	4935			PSEUDO	authentic frameshift
BBN13	8289	8742			PSEUDO	authentic frameshift
BBN14	8742	8975	SHORT			probably a real gene; has paralogs on other cp32s
BBN16	10283	11034			PSEUDO	authentic frameshift
BBN18	12009	12560			PSEUDO	authentic point mutation
BBN21	13807	14410			PSEUDO	authentic frameshift
BBN22	14423	15320			PSEUDO	authentic frameshift
BBN23	15312	15512	SHORT			probably a real gene; has paralogs on other cp32s
BBN29	18783	17776			PSEUDO	authentic point mutation
BBN37	25779	25006			PSEUDO	authentic point mutation
BBN40	27991	27884	*	QUESTIONABLE		gene not called in paralogous sequence elsewhere

lp5
BBT01	195	635			PSEUDO	[57] fragment
BBT02	744	1094			PSEUDO	[57] fragment
BBT03	1208	1573			?	[84] ([57] fragment?)
BBT05	3200	3350	*		PSEUDO	[57] fragment
BBT07	4388	4816			PSEUDO	[52] C-terminal fragment

lp17
BBD001	214	405	SHORT			no homolog outside of Borrelia
BBD02	873	1019	*		PSEUDO	[77] ([57] fragment?)
BBD03	1117	1309	*		PSEUDO	[57] fragment
BBD04	1412	1765			PSEUDO	[57] fragment
BBD05	2389	2541	SHORT		?	[84] ([57] fragment?)
BBD05.1	3018	3604			PSEUDO	[57] fragment
† BBD06	3143	3604		QUESTIONABLE		in-frame inside of D05.1
BBD07	4373	4260	SHORT			no homolog outside of Borrelia
BBD08	4707	4802	*		PSEUDO	[82] fragment
BBD12	7752	7624	SHORT			no homolog outside of Borrelia
BBD15.01	10000	9940	*		PSEUDO	[175] fragment
BBD15.1	10152	10326	*		PSEUDO	[82] fragment
BBD16	10520	10428	SHORT			no homolog outside of Borrelia
BBD17	10591	10683	SHORT			no homolog outside of Borrelia
BBD19	12057	12167	SHORT			no homolog outside of Borrelia
BBD20	12250	12975			PSEUDO	[82] fragment
BBD22	14072	14338	SHORT			no homolog outside of Borrelia
BBD23	14781	15725			PSEUDO	[82] fragment
BBD24	16121	15894	SHORT			no homolog outside of Borrelia
BBD25	16212	16367	SHORT			no homolog outside of Borrelia

lp21
BBU01	184	615			PSEUDO	[57] fragment
BBU02	746	1111			?	[84] ([57] fragment?)
BBU03	1357	1241	SHORT			no homolog outside of Borrelia
BBU07	15349	15810			PSEUDO	[57] fragment
BBU08	15791	16081	*		PSEUDO	[137] fragment
BBU09	26548	16231			PSEUDO	[55] fragment
BBU10	16603	16797	*		PSEUDO	[57] fragment
BBU12	17918	18362			PSEUDO	[52] authentic frameshift

lp25
BBE01	255	157	SHORT			no homolog outside of Borrelia
BBE03	4613	4422	SHORT			no homolog outside of Borrelia
BBE04	4719	4856			PSEUDO	family [54] fragment
BBE04.1	5377	5734			PSEUDO	family [44] fragment
† BBE05	5377	5526	*	QUESTIONABLE		E05 inside E04.1 and out of frame
BBE06	5757	5903	SHORT			no homolog outside of Borrelia
BBE07	6401	6185	*		PSEUDO	[26] fragment
BBE08	6701	6558	SHORT			no homolog outside of Borrelia
BBE10	7972	7877	SHORT			no homolog outside of Borrelia
BBE11	8446	8315	SHORT			no homolog outside of Borrelia
BBE12	8646	8524	SHORT			no homolog outside of Borrelia
BBE13	8863	8955	SHORT			no homolog outside of Borrelia
BBE14	9163	9375	SHORT			no homolog outside of Borrelia
BBE15	9490	9356	SHORT			no homolog outside of Borrelia
BBE21.1	14767	14893	*		PSEUDO	[82] fragment
BBE23	15973	16155	SHORT			no homolog outside of Borrelia
BBE23.1	16459	16540	*		PSEUDO	[57] fragment
BBE23.2	16540	16721	*		PSEUDO	[32] fragment
BBE24	16915	17169	*		PSEUDO	[49] fragment
BBE24.1	17902	18303			PSEUDO	[49?] fragment - see paralog list
BBE25	18606	18505	SHORT			no homolog outside of Borrelia
BBE26	18586	18711	SHORT			no homolog outside of Borrelia
BBE27	19055	19195	SHORT			no homolog outside of Borrelia
BBE28	19489	19340	SHORT			no homolog outside of Borrelia
BBE29	19697	20883			PSEUDO	DNA methyltransferase pseudogene
BBE29.1	21110	21476			PSEUDO	[102] fragment
BBE30	21558	21701	*		PSEUDO	[49] fragment
BBE32	23723	23418			PSEUDO	[57] fragment
BBE33	24100	23850	*		PSEUDO	[57] fragment

lp28-1
BBF001	1	163	*		PSEUDO	[88] fragment
BBF001.1	200	300	*		PSEUDO	[80] fragment
BBF02	1720	2073			PSEUDO	[88] fragment
BBF03	2619	2101			PSEUDO	[80] fragment
BBF04	2658	2804	*		PSUEDO	[77] ([57] fragment?)
BBF05	2777	3073	*		PSEUDO	[57] fragment
BBF06	3201	3377	*		PSEUDO	[57] fragment / overlaps K45 homology
BBF07	3529	3413	SHORT			no homolog outside of Borrelia
BBF08	3849	3685	*		PSEUDO	[72] authentic frameshift
BBF09	3962	4179	*		PSEUDO	[71] authentic frameshift
BBF11	5435	5539	*	QUESTIONABLE		inside BBF11.1 and backwards
BBF11.1	5620	5412	*		PSEUDO	[32] fragment
BBF12	6540	5956			?	patches of [49] homology; fusion pseudogene?
BBF14.1	8197	8367	*		PSEUDO	[65] authentic frameshift
BBF16	8389	8607	*		PSEUDO	[64] authentic point mutation
BBF17	8772	9026	*		PSEUDO	[68] authentic frameshift
BBF18	9561	10049			PSEUDO	[82] pseudogene
† BBF19	10559	10036		QUESTIONABLE		(BBF19 is an inverted part of BBF18)
BBF19.1	10916	11200	*		PSEUDO	[175] fragment
BBF20	10991	10701	*		PSEUDO	[85] fragment
BBF21	11550	11449	SHORT			no homolog outside of Borrelia
BBF22	12018	11794	*		PSEUDO	[44] fragment
BBF26.1	16209	15663			PSEUDO	badly deleted [101] pseudogene
† BBF27	15925	15758	*	QUESTIONABLE		in frame inside F26.1
† BBF28	16129	16001	*	QUESTIONABLE		out of frame (?) inside F26.1
BBF29	16825	16457			PSEUDO	[49] fragment (patchy similarity)
BBF30	17415	17170	SHORT			no homolog outside of Borrelia
BBF31	17805	17394	*		PSEUDO	[50] fragment
BBF31.1	17920	18050			PSEUDO	[57] fragment
BBF32	26698	18430			PSEUDO	vlsE recombination cassette; apparently functional but not transcribed; In the wider sense BBF32 contains 15 unexpressed pseudogenes (Zhang et al., 1997).

lp28-2
BBG03	2104	2492			PSEUDO	[48] fragment
BBG04	2857	2753	SHORT			no homolog outside of Borrelia
BBG05	4056	2894			PSEUDO	one frameshift relative to homologous transposases of this type
BBG11	11015	10779	SHORT			no homolog outside of Borrelia
BBG31	26567	27082			PSEUDO	N-terminal truncation of family [50]

lp28-3
BBH01	273	464	SHORT			no homolog outside of Borrelia
BBH03	926	1072	*		PSEUDO	[77] ([57] fragment?)
BBH04	1045	1365			PSEUDO	[57] fragment
BBH05	1498	1677	*		PSEUDO	[57] fragment
BBH07	3514	3086			PSEUDO	[50] fragment
BBH08	3730	3593	SHORT			no homolog outside of Borrelia
BBH09.1	8091	7810	*		PSEUDO	[92] fragment
BBH10	8203	8003	*	QUESTIONABLE		partially overlaps BBH09.1 backwards
BBH10.1	8240	8310	*		PSEUDO	[82] fragment
BBH11	8796	8704	*	QUESTIONABLE		backwards inside BBH11.1
BBH11.1	8320	8850			PSEUDO	[1] fragment (in part)
BBH12	9455	9589	SHORT			no homolog outside of Borrelia
BBH14	10934	10821	SHORT			no homolog outside of Borrelia
BBH15	11005	10913	SHORT			no homolog outside of Borrelia
BBH16	11068	11187	SHORT			no homolog outside of Borrelia
BBH17	11837	12025	SHORT			no homolog outside of Borrelia
BBH18.1	13571	13693	*		PSEUDO	[65] fragment
BBH19	13590	13709	*	QUESTIONABLE		overlaps BB18.1 partly in-frame
BBH20	14596	13840			PSEUDO	[171] fragment
BBH20.1	14750	15300			PSEUDO	[104] fragment
BBH22	14870	14766	*	QUESTIONABLE		backwards inside BBH20.1
† BBH23	15051	15158	*	QUESTIONABLE		in-frame inside BBH20.1
† BBH24	15136	15342	*	QUESTIONABLE		mostly within BBH20.1
BBH24.1	15354	15750			PSEUDO	[86] fragment
BBH25	15810	15568	*	QUESTIONABLE		backwards inside BBH24.1
BBH30	20871	20415			PSEUDO	[96] fragment
BBH31	20997	21104	SHORT			no homolog outside of Borrelia
BBH33	22678	22950	*		PSEUDO	[61] fragment
BBH34	23383	23192	*		PSEUDO	[62] fragment
BBH35	23447	23560	SHORT			no homolog outside of Borrelia
† BBH36	24180	24031	*	QUESTIONABLE		in frame inside H36.1
BBH36.1	24223	24041	*		PSEUDO	[44] fragment
BBH36.2	24751	25112			PSEUDO	[102] fragment
BBH38	26614	26498	SHORT			no homolog outside of Borrelia
BBH39	26754	26855	SHORT			no homolog outside of Borrelia
BBH40	27445	26981			PSEUDO	[82] fragment

lp28-4
BBI01	174	605			PSEUDO	[57] fragment
BBI02	736	1101			?	[84] (fragment of [57]?)
BBI02.1	1416	1346	*		PSEUDO	[172] fragment
BBI02.2	1617	1862	*		PSEUDO	[57] fragment
BBI03	1972	1850	SHORT			no homolog outside of Borrelia
BBI04	2219	2127	SHORT			no homolog outside of Borrelia
BBI05	2310	2191	SHORT			no homolog outside of Borrelia
BBI07	3441	3346	SHORT			no homolog outside of Borrelia
BBI08	3576	3752	*	QUESTIONABLE		overlaps BBI08.1 at C-terminus
BBI08.1	3674	4314			PSEUDO	[59] fragment
† BBI09	3745	3879	*	QUESTIONABLE		in-frame inside I08.1
† BBI10	3911	4312		QUESTIONABLE		in-frame inside I08.1
BBI11	4721	4626	SHORT			no homolog outside of Borrelia
BBI12	5128	5343	SHORT			no homolog outside of Borrelia
BBI13	5609	5704	SHORT			no homolog outside of Borrelia
BBI14	6159	6269	*		PSEUDO	[60] fragment
BBI15	6603	6830	*		PSEUDO	[60] fragment
BBI17	8967	8824	SHORT			no homolog outside of Borrelia
BBI18	10647	10498	SHORT			no homolog outside of Borrelia
BBI23	13989	14090	SHORT			no homolog outside of Borrelia
BBI24	14334	14438	SHORT			no homolog outside of Borrelia
BBI25	15211	15339	SHORT			no homolog outside of Borrelia
BBI27	17272	17096	*		PSEUDO	[60] fragment
BBI30	19403	19507	SHORT			no homolog outside of Borrelia
BBI31.1	20240	20340	*		PSEUDO	[98] fragment
BBI32	20479	20273	*	QUESTIONABLE		backwards inside of BBI31.1
BBI33	20482	20589	*		PSEUDO	[82] fragment
BBI35	21992	22090	*	QUESTIONABLE		paralog not called in paralogous sequence elsewhere
BBI37	23056	23154	*	QUESTIONABLE		paralog not called in paralogous sequence elsewhere
BBI40	25320	25802	*		PSEUDO	[49] fragment
BBI41	26036	25797			PSEUDO	[82] fragment
BBI43	27069	26884	*		PSEUDO	[55] fragment - see paralog list

lp36
BBK001	86	14	*		PSEUDO	[82] fragment
† BBK02	2478	1213		QUESTIONABLE		in frame inside K02.1
BBK02.1	3770	1213			PSEUDO	pseudogene in [1]
† BBK03	3222	2821		QUESTIONABLE		in frame inside K02.1
† BBK04	3595	3419	*	QUESTIONABLE		in frame inside K02.1
BBK05	5096	4905	SHORT			no homolog outside of Borrelia
BBK06	5126	5233	SHORT			no homolog outside of Borrelia
BBK08	6281	6180	SHORT			no homolog outside of Borrelia
BBK09	6366	6647	SHORT			no homolog outside of Borrelia
BBK10	6983	6807	*		PSEUDO	[1] fragment
BBK11	6956	7060	SHORT			no homolog outside of Borrelia
BBK14	8921	9013	SHORT			no homolog outside of Borrelia
BBK16	10223	10101	*		PSEUDO	[32] fragment
BBK18	12143	12054	SHORT			conserved hypothetical protein
BBK20	13212	13301	SHORT			no homolog outside of Borrelia
BBK24.1	17380	17580	*	QUESTIONABLE		inside BBK25 and backwards
BBK25	17565	16969			PSEUDO	[82] fragment
BBK25.1	17880	20033			PSEUDO	[1] fragment
† BBK26	18346	18462	*	QUESTIONABLE		in frame inside of K25.1
BBK27	19094	18807	*	QUESTIONABLE		backwards inside of BBK25.1
† BBK28	19232	19348	*	QUESTIONABLE		in frame inside of K25.1
† BBK29	19807	19718	*	QUESTIONABLE		in frame inside of K25.1
† BBK30	19935	20033	*	QUESTIONABLE		in frame inside of K25.1
BBK31	20026	20166	SHORT			no homolog outside of Borrelia
BBK33	21720	21890	*		PSEUDO	[65] fragment
BBK34	21912	22130	SHORT			no homolog outside of Borrelia
BBK35	22294	22464	SHORT			no homolog outside of Borrelia
BBK36	22545	22646	SHORT			no homolog outside of Borrelia
BBK37	23953	22913			PSEUDO	[175 & 75] pseudogene
BBK38	24146	23922	SHORT			no homolog outside of Borrelia
BBK39	24293	24667			PSEUDO	[59] fragment
BBK42	26803	26588	SHORT			no homolog outside of Borrelia
BBK42.1	26916	27078	SHORT			no homolog outside of Borrelia
† BBK43	26937	27041		QUESTIONABLE		largely in-frame inside of BBK42.1
BBK44	27234	27350	SHORT			no homolog outside of Borrelia
BBK46	29212	28394			PSEUDO	[75] authentic frameshifts
BBK51	34232	34327	SHORT			no homolog outside of Borrelia
BBK52.1	35722	35811	*		PSEUDO	[174] authentic frameshift
BBK54	36577	36392	SHORT			[55] fragment? - see paralog list

lp38
BBJ001	482	1208			PSEUDO	[60] fragment
† BBJ01	482	664	*	QUESTIONABLE		in frame inside J001
† BBJ02	927	1208	*	QUESTIONABLE		in frame inside J001
BBJ02.1	1475	2367			PSEUDO	[48] fragment
† BBJ03	1593	1742	*	QUESTIONABLE		in frame inside of BBJ02.1
BBJ04	2381	2271	*	QUESTIONABLE		backwards inside of J02.1
BBJ05	3828	2768			PSEUDO	[82] fragment
BBJ06	3486	3629	*	QUESTIONABLE		backwards inside of BBJ05
† BBJ07	4307	4167	*	QUESTIONABLE		inside J07.1
BBJ07.1	4409	4167	*		PSEUDO	[98] fragment
BBJ10	7270	7473	*		PSEUDO	[58] fragment
BBJ11	7965	7783	SHORT			no homolog outside of Borrelia
BBJ11.1	8070	8260	*		?	[171] fragment (weak - not in TIGR gene list)
BBJ12	8725	8636	*	QUESTIONABLE		inside of and out-of-frame with BBJ12.1
BBJ12.1	8782	8593	*		PSEUDO	[86] fragment
BBJ13	9155	8880	*		PSEUDO	[69] fragment
BBJ14	9125	9283	*	QUESTIONABLE		overlaps BBJ13 backwards
BBJ15	10168	10043	*	QUESTIONABLE		inside BBJ15.1 and backwards
BBJ15.1	9450	10150			PSEUDO	[105] fragment
BBJ20	13936	13775	*		PSEUDO	[167] pseudogene
BBJ21	15514	15657	*	QUESTIONABLE		backwards inside BBJ21.1
BBJ21.1	15976	15484	*		PSEUDO	[138] fragment
BBJ22	16003	15905		QUESTIONABLE		overlaps BBJ21.1 in part
BBJ30	23018	23119	SHORT			no homolog outside of Borrelia
BBJ32	24517	24389	SHORT			no homolog outside of Borrelia
BBJ33	24681	24791	SHORT			no homolog outside of Borrelia
BBJ35	26858	26959	SHORT			no homolog outside of Borrelia
BBJ37	28442	28281	SHORT			no homolog outside of Borrelia
BBJ38	28703	28608	SHORT			no homolog outside of Borrelia
BBJ39	29401	29267	SHORT			no homolog outside of Borrelia
BBJ39.1	29680	29600			PSEUDO	[54] fragment
BBJ40	29827	29919	*	QUESTIONABLE		paralog not called between BBJ41 and BBJ42
BBJ42	31133	30945	SHORT		?	possible [54] fragment (similarity not great; not in TIGR paralog list)
BBJ44	32150	32251	SHORT			no homolog outside of Borrelia
BBJ45.1	33652	33522	*		PSEUDO	[173] authentic frameshift
BBJ46	34668	34375	SHORT			no homolog outside of Borrelia
BBJ49	36455	36315	*		PSEUDO	[92] fragment
BBJ50	36502	37203			PSEUDO	authentic point mutation (see annotated gene list)
BBJ51	38522	37382			PSEUDO	[170] fragment/authentic frameshift

lp54
BBA02	1238	1122	SHORT			no homolog outside of Borrelia
BBA06	4342	4226	SHORT			no homolog outside of Borrelia
BBA12	8202	8378	SHORT			no homolog outside of Borrelia
BBA17	11390	11301	SHORT			no homolog outside of Borrelia
BBA22	15084	15239	SHORT			no homolog outside of Borrelia
BBA26	17386	17514	SHORT			no homolog outside of Borrelia
BBA27	17563	17679	SHORT			no homolog outside of Borrelia
BBA28	17906	17757	SHORT			no homolog outside of Borrelia
BBA29	18019	17897	SHORT			no homolog outside of Borrelia
BBA32	20654	20845	SHORT			no homolog outside of Borrelia
BBA35	23391	23284	SHORT			no homolog outside of Borrelia
BBA49	32678	32893	SHORT			no homolog outside of Borrelia
BBA53	35890	36162	SHORT			no homolog outside of Borrelia
BBA54	36192	36467	SHORT			no homolog outside of Borrelia
BBA58	39566	39766	SHORT			no homolog outside of Borrelia
BBA59	40048	39812	SHORT			12 kd lipoprotein
BBA62	42203	42406	SHORT			7.5 kd lipoprotein
BBA63	42576	42454	SHORT			no homolog outside of Borrelia
BBA67	46021	46197	SHORT			no homolog outside of Borrelia
BBA70	49158	48523			PSEUDO	[54] fragment
BBA71	49796	49386			PSEUDO	[54] fragment
BBA72	50031	49792	SHORT			no homolog outside of Borrelia
BBA75	52591	52496	SHORT			no homolog outside of Borrelia

lp56
BBQ01	279	545	*		PSEUDO	[55] fragment? see paralog list
BBQ02	710	799	*	QUESTIONABLE		paralog not called in right end of lp28-4
BBQ04	1404	2265			PSEUDO	[44] authentic frameshift
BBQ10	6674	6339			PSEUDO	[51] fragment; result of cp32 integration
BBQ11	6586	6800			PSEUDO	[148] fragment; result of cp32 integration
BBQ16	9238	9624			PSEUDO	[108] authentic frameshift
BBQ21	12193	12426	SHORT			probably a real gene; has paralogs on other cp32s
BBQ30	18713	18913	SHORT			probably a real gene; has paralogs on other cp32s
BBQ36	21424	21513	*	QUESTIONABLE		paralog not called in paralogous sequence elsewhere
BBQ46	29559	29651	*	QUESTIONABLE		paralog not called in paralogous sequence elsewhere
BBQ51	33873	35095			PSEUDO	[146] authentic frameshift
BBQ54	36389	37132			PSEUDO	[148] fragment; result of cp32 integration
BBQ55	37533	36933			PSEUDO	[51] fragment; result of cp32 integration
BBQ56	37809	37672	SHORT			no homolog outside of Borrelia
† BBQ57	38223	37819		QUESTIONABLE		in frame and inside of BBQ60
† BBQ58	38514	38419	*	QUESTIONABLE		in frame and inside of BBQ60
† BBQ59	39077	38568		QUESTIONABLE		in frame and inside of BBQ60
BBQ60	39360	37817			PSEUDO	[101] fragment
† BBQ61	39482	39360	*	QUESTIONABLE		in frame and inside of BBQ63
BBQ62	39531	39902		QUESTIONABLE		backwards and inside of BBQ63
BBQ63	39934	39400			PSEUDO	[117] fragment
† BBQ64	40186	39962	*	QUESTIONABLE		inside of and in-frame with BBQ65
BBQ65	40218	39961	*		PSEUDO	[103] fragment
BBQ66	40317	40409	SHORT			no homolog outside of Borrelia
BBQ67	43732	40439			PSEUDO	putative adenine specific DNA methyltransferase (e.g., BBE29 [167]) fused to [102] - like sequences
† BBQ68	44232	43918		QUESTIONABLE		in-frame and inside of BBQ69
BBQ69	44581	43769			PSEUDO	[138] authentic frameshift/fragment
† BBQ70	44612	44511	*	QUESTIONABLE		in-frame in BBQ69 in part
BBQ71	44582	45263			PSEUDO	[105] fragment
BBQ72	45314	45427	SHORT			no homolog outside of Borrelia
BBQ73	45630	45530	*		PSEUDO	[60] fragment
BBQ74	46462	45804			PSEUDO	[60] fragment
BBQ75	46671	46781	*		PSEUDO	[168] fragment
BBQ76	46982	47077	SHORT			no homolog outside of Borrelia
BBQ77	47163	47279	*		PSEUDO	contains a [82] fragment which may be part of one deleted pseudogene that includes BBQ79
BBQ78	47295	47393	*	QUESTIONABLE		out of frame inside BBQ81
BBQ79	47273	47596			PSEUDO	[82] fragment
BBQ80	48626	47787	*		PSEUDO	[60]fragment
BBQ81	49246	49047	*		PSEUDO	[48] fragment
BBQ82	49538	49347	*		PSEUDO	[76] fragment
BBQ83	49868	49755	SHORT			no homolog outside of Borrelia
BBQ84	50550	50398	*		PSEUDO	[84] fragment (also [57] fragment?)
BBQ84.1	50900	50700	*		PSEUDO	[169] authentic frameshift
BBQ85	51528	51175			PSEUDO	[57] fragment
BBQ86	51823	51722	*		PSEUDO	[57] fragment
BBQ87	52067	51921	*		PSUEDO	[77] ([57] fragment?)
BBQ89	52726	52535	SHORT			no homolog outside of Borrelia

Large Chromosome pseudogenes (and short and questionable genes in rightmost 7.2 kbp)
BB0119	117763	116828			PSEUDO	single authentic frameshift
BB0843.1	903255	903415	*		PSEUDO	[32] fragment
BB0845	905120	905224	*	QUESTIONABLE		inside BB0845.1 and backwards
BB0845.1	905255	905025	*		PSEUDO	[76] pseudogene
BB0845.11	905395	905295	*		PSEUDO?	[166] fragment; possible pseudogene; this is a relatively poor homolog and is not included in the TIGR analysis
BB0845.2	905475	905775	*		PSEUDO	[105] fragment
BB0846	905865	905755	*	QUESTIONABLE		overlaps BB845.3 backwards
BB0847	905839	905943	SHORT
BB0848	905928	906029	SHORT
BB0848.1	906075	906275	*		PSEUDO	[82] fragment
BB0849	906162	906260	*	QUESTIONABLE		inside BB0848.1
BB0849.1	906725	906275			PSEUDO	[57] fragment
BB0849.2	907225	908225			PSEUDO	[1] fragment
BB0853	910175	909845			PSEUDO	[57] fragment
BB0853.1	910555	910375	*		PSEUDO	[57] fragment

Part V

Direct, Tandem Repeat Arrays of "Short" Sequences and "Long" Inverted Repeats in the B. burgdorferi B31 Plasmids

This compilation was not done in a completely rigorous fashion, so there may be additional short tandem repeat arrays on the B31 plasmids. The roles of these repeats are unknown with the exception of the vlsE cassettes on lp28-1 (Zhang et al., 1997).

Plasmid	Unit Length (bp)	# of repeats	bp in array	in gene? (location)	Paralogous gene family	Typical repeat unit sequence

lp17	21	8.3	175	no (13154)	--	TAATTAATATGTGATATAAAA

lp21	63	176.2	11,004	no (3618)	--	ATAAATCATATAAATAAATATTTCATAAATAAT AAGTAAAAGTGGTTTAGTTTTGGAGTGTAT (see below)

lp28-1	33(A)	2.5	83	BBF03	[80]	tactactaagattgatactgttaaaagcgaact
lp28-1	33(B)	3.1	101	BBF03	[80]	ggaatccaataacaaagttcttttggaaaagct
lp28-1	~570	15	8800	BBF32	[170]	vlsE pseudogene cassettes

lp28-2	87(A)	3.1	272	BBG33	[80]	CAATCTTGTTACTAAGATTGATACTGTTAAAAG TGAACTTACTACTAAGATTGATAATGTAGAAAA GAATTTACAAAAGGATATATC
lp28-2	33(B)	4.4	145	BBG33	[80]	AAAGCTGGAAGCCAATAACAAACTTCTTTTGGA

lp28-3	54(A)	5.6	304	BBH13	[80]	tagaaaagaatttacaaaaagacatatttaatt tagatgctaagatagattctg

lp28-4	27	21.5	661	BBI16	[60]	aacagaagaagagcttaagaaaaaaca

lp38	17	7.6	125	no (5938)	--	AATTGATATTAAAATAT
	7	12.3	86	no (10287)	--	TAATAGT

lp54	11	7.1	78	no (20128)	--	TAAATCAATAT

cp32-3	54	3.6	194	BBS29	[80]	ATACCAAGATAGATAATGTAGAAAAGAATTTAC AAAAAGATATATCTAATTTAG

cp32-3	87	4.1	354	BBS37	[80]	TTTAAACACTAAAATAGACAATGTTGAAAAGAA TTTAAATCTAAAAATAGATAATTTAGACTCTAA AATAGATACTGTAGAAAAGAA (note that this complex 87 bp repeat is actually made up of two parts, a 54 bp part and a 33 bp part that is a fragment of the 54 bp sequence).

Each of the cp32s have an "ortho-paralog" of both BBS29 and BBS37 (except cp32-1 and cp32-6, which have only a ortho-paralog of BBS37), that are not listed here. All of these do contain similar repeats. W. Zuckert has performed a more detailed analysis of the family 80 repeats and named these genes "bdr" for Borrelia direct repeat (Zuckert, Meyer & Barbour, 1999).

The lp21 "63 bp repeat tract" is a tandem array of 176 near repeats of a 63 bp sequence. The 63 bp sequence unit is actually made up of 34 different, very similar sequences (analysis by G. Sutton & S. Casjens). In the table below, the three columns represent: (1) a letter name given to each type of 63 bp repeat unit, (2) the number of that particular repeat unit present in the lp21 array, and (3) the sequence of that type of repeat unit.

The types of repeat units appear in the order given below. Note that single underline and double underline indicate the two major larger perfect repeats of a contiguous group of 63 bp units within the array (i.e., large perfect sequence repeats) that probably indicate recent duplications of sections of the array; some smaller pieces (e.g., "w, l, q, q") of these groups can also be found elsewhere in the array. The longest tandem group of perfect 63 bp repeats is 3 "q" repeats in a row.

Each of the cp32s, the cp32-like portion of lp56 and cp9 carry a similar pair of ~180 bp inverted repeats. Each plasmid carries a left inverted repeat unit (IRL) and a right inverted repeat unit (IRR) which surround the putative plasmid partitioning gene cluster (Casjens et al., 2000).

These inverted repeats are not all completely identical; in some locations all IRL’s are more like each other than they are like the IRR’s (e.g., some members in tier 1 below), and in other places IRL’s from one plasmid are more like IRR’s from the same plasmid than they are like IRL’s or IRR’s from other plasmids (some members in tier 3 below). Below, we indicate the presence of smaller inverted repeats within the larger repeat units as follows (---> <---).

Each of the inverted repeat units overlaps a putative gene such that the ATG marked with asterisks (***) is the most likely start codon. Each of these has a credible Shine-Dalgarno ribosome binding site marked by "xxxx"; a "====>" indicates the 5’-portion of the putative gene which is translated outward from the repeat unit. A paralogous family 161 gene (previously called ORF-4 family) gene starts within each IRL and a family 165 gene (previously called ORF-8/7 family) starts within each IRR; curiously, these two (otherwise unrelated) protein families will have very similar 13-15 N-terminal amino acid sequences. In some, but not all of these genes, the above open reading frame extends 5’ of the marked ATG to the TTG marked with bullets (•••), but its ribosome binding site is not as credible as that of the ATG described above.

The roles of these inverted repeats are unknown, but they are positioned such that one might expect an outward directed promoter to initiate transcription in each of them. It is thus possible, or even likely, because of the extreme similarity of these regions, that these outward-directed promoters might be coordinately controlled.

It is interesting to note that these inverted repeats do not surround similar "partitioning" gene clusters on the linear plasmids, where family 161 and 165 genes are not located adjacent to the "partitioning" gene cluster.

The inverted repeat sequences below are named as follows: each of the cp32’s is indicated simply by its cp32 number, lp56 is indicated by "56" and cp9 by "cp9". Note that cp32-5, which is not present in strain B31 MI but is present in some other B31 cultures, is included in this analysis.

	Inside end
	--——————————————————>............<————————————————
1-IRL	ACGGG..CTTAACTAATTTCTTTAGTAGATAATAGAGAATTTAGCTAAGC
3-IRL	ATGGG..CTTAGCTAAGTTCTTTAACA......AGAGAACGTAGCTAAGC
4-IRL	GTGGGAACTTGGCGAAATTCTTTTTAA......AGGGAATTTGGTTAAGT
5-IRL	TAGGG..ATTAACTAAGTTTTTTAGTAGATAATAGAAAATTTAGCTAAGC
6-IRL	GTGGGGACTTAACGAGATTCTTTAAGA......AAAGAGTTTGGTTAAGT
7-IRL	TTGGGGACTTAACGAGATTCTTTGAGA......AAAGAGTTTGGTTAAGT
8-IRL	ACGGG..CTTAACTAATTTCTTTAGTAGATAATAGAGAATTTAGCTAAGC
9-IRL	ATGGG..CTTAACTAAGTTCTTTAACA......AGAGAATTTAGCTAAGC
56-IRL	ACGGG..CTTAACTAATTTCTTTAGTAGATAATAGAGAATTTAGCTAAGC
cp9-IRL	TAGGG.. CTTTACTAAGTTCTTTTAAA......AGAGAATTTAGCAAAGC
1-IRR	TTGGG..TTTAGCTAAGTTCTTTAACA......AGAGAATTTAGCTAAGC
3-IRR	TTGGG..TTTAGCTAAGTTCTTGGATA......AGAGAATTTAAATAAAC
4-IRR	TTGGG..TTTAGCTAAGTTCTTTAACA......AGAGAATTTAAATAAGC
6-IRR	TTGGG..TTTAGCTAAGTTCTTTAACA......AGAGAATTTAAATAAGC
7-IRR	TTGGG..TTTAGCTAAGTTCTCTAACA......AGAGAATTTAAATAAGC
8-IRR	TTGGG..TTTAGCTAAGTTCTTAGACA......AGAGAATTTAAATAAGC
9-IRR	TTGGG..TTTAGCTAAGTTCTTTAACA......AGAGAATTTAAATAAGT
56-IRR	TTGGG..TTTAGCTAAGTTCTTAGATA......AGAGAATTTAAATAAAC
cp9-IRR	TAGGG..CTTTTCTAAGTTCTTTTAAA......AGAGAATTTAGTAAAGC

	————....————————————>..<———————————....————
1-IRL	CC....TATTTTTTTGTAAAATTTTTTGTAAAAAAG....TTGGCAAAAA
3-IRL	CCG...CACCTTTTTGTAAAGATTTTTGTAAAAAAG....TTGGCAAAAA
4-IRL	CCCAC.TTCTTTTGTGTAAAATTTTTTGTAAAAAAG....TTGGCAAAAA
5-IRL	CC....TAATTTTTTGTAAAAATTTTTGTAAAAAAG....TTGGCAAAAA
6-IRL	CCCAC.TTCTTTTTTGTAAAAATTTTTGTAAAAAGC....CTGACAAAAA
7-IRL	CCCAC.TTCTTTTTTACAAAAATTTTTGTAAAAAAG....TTGGCAAAAA
8-IRL	CC...TATTTTTTTTGTAAAAATTTTTGTAAAAAAG....TTGGCAAAAA
9-IRL	CCGCAC...TTTTTGTAAAAATTTTTTGTAAAGAAG....TTGGCAAAAA
56-IRL	CC...TAT.TTTTTTGTAAAAATTTTTGTAAAAAAG....TTGGCAAAAA
cp9-IRL	CCTA..AGTCTTTTAACAAAAATTTTTATTAAAAAA..AGTTGACAAAAA
1-IRR	CC...TAT.TTTTTTGTAAAATTTTTTGTAAAAAAG....TTGGCAAAAA
3-IRR	CCAACTAT.TTTTTTACAAAAATTTTTGTAAAAAAAAAAGTTGGCAAAAA
4-IRR	CCAACTA.ATTTTTTGTAAAATTTTTTGTAAAAAAG....TTGGCAAAAA
6-IRR	CCAACTAT.TTTTTTGTAAAAATTTTTGTAAAAAAG....TTGGCAAAAA
7-IRR	CCAACTAA.TTTTTTGTAAAATTTTTTGTAAAAAAG....TTGGCAAAAA
8-IRR	CCAACTATTTTTTTTGTAAAGATTTTTGTAAAAAAG....TTGGCAAAAA
9-IRR	CCAACTA.TTTTTTTGTAAAAATTTTTGTAAAAAAG....TTGTCAAAAA
56-IRR	CCAACTA.TTTTTTTGTAAAATTTTTTGTAAAAAAG...CCTGACAAAAA
cp9-IRb	CCTA..AGTGTTTTAATAAAAAATTTTTTGTAAAAA..AGTTGGCAAAAA

	......•••..................................xxxx
1-IRL	TAGTTTTTGCTATATACTTATTTTTATAAATAACC..ATA...GGAGTAA
3-IRL	TAGTTTTTGCTATATATTTATTTTTAT..ACAAAT..ATAA..GGAGAAA
4-IRL	TAGTTTTTGCTATATAATTA..TTTATTACAA....AATAA..GGAGGAA
5-IRL	TAGTTTTTGCTATATACTTATATTTATTAATACCA..ATTAAAGGAGGAA
6-IRL	TAGTTTTTGCTATATACTTAT..TTATTACTAA....ATAA..AGGAGGA
7-IRL	TAGTTTTTGCTATATACTTATATTTATTACTAT....AAAA..GGAGTAA
8-IRL	TAGTTTTTGCTATATACTTATATTTATTAATACAA..ACAA..GGAGGAA
9-IRL	TAGTTTTTGCTATATACTTATATTTATTAATACAT..ATAAACGGAGGAA
56-IRL	TAGTTTTTGCTATATACTTATATTTATTGAAAA...AACA...GGAGGAA
cp9-IRa	TAGTTTTTGCTATATATTTATATATAAGAAAATTATAACTTACGGAGTAA
1-IRR	TAGTTTTTGCTATATACTTATTTTTATAAATAACC..ATA...GGAGTAA
3-IRR	TAGTTTTTGCTATATATTTATTTTTAT.ACAAAT...ATAA..GGAGAAA
4-IRR	TAGTTTTTGCTATATAATTAT..TTATTACAA....AATAA..GGAGGAA
6-IRR	TAGTTTTTGCTATATACTTAT..TTATTACTA....AATAA..AGGAGGA
7-IRR	TAGTTTTTGCTATATACTTATATTTATTACTATAA.AA.....GGAGTAA
8-IRR	TAGTTTTTGCTATATACTTATATTTATTAATACA..AACAA..GGAGGAA
9-IRR	TAGTTTTTGCTATGTAATTAT.....TTATTACAA.AATAA..GGAGGAA
56-IRR	TAGTTTTTGCTATATACTTATATTTTTTACTATAA.AA.....GGAGTAA
cp9-IRb	TAGTTTTTGCTATATATTTATATATAAGAAAATTATAACTTGCGGAGTAA

	....***=============================>translation
1-IRL	AAAGATGGAAAATCTTTCAAACAATAAT...CAAGAAATACAAAATAATA
3-IRL	AAAGATGGAAAATCTTTCAAACAATAATAATC......CACAAGAAAATA
4-IRL	AAAGATGGAAAATCTTTCAAACAATAATAATC......CACAAGAAAATA
5-IRL	AAAGATGGAAAATCTTTCAAACAATAATAATCAAGAAATACAAAATAATA
6-IRL	AAACATGAACAATGTTTCAAACAATAATAATCAAGAAATACAAAATAATA
7-IRL	AAAGATGGAAAATCTTTCAAACAATAATAATCAAGAAATACAAAATAATA
8-IRL	AAAGATGGAAAATCTTTCAAACAATAAT...CAAGAAATACAAAATAATA
9-IRL	AAAGATGGAAAATCTTTAAAACAATAATAATC......CACAAGAAAATA
56-IRL	AAAGATGGAAAATCTTTCAAACAATAATAATCAAGAAATACAAAATAATA
cp9-IRa	AAAAATGAAAAACC..GCAAA.AACAATAATC......CACAAGAAATTA
1-IRR	AAAGATGGAAAATCTTTCAAACAATAATAATC......CACAAGAAAATA
3-IRR	AAAGATGGAAAATCTTTCAAACAATAATAATC......CACAAGAAAATA
4-IRR	AAAGATGGAAAATCTTTCAAACAATAATAATC......CACAAGAAAATA
6-IRR	AAACATGAACAATGTTTCAAACAATAATAATC......CACAAGACAATA
7-IRR	AAAGATGGAAAATCTTTCAAACAATAATAATC......CACAAGAAAATA
8-IRR	AAAGATGGAAAATCTTTCAAACAATAATAATC......CACAAGAAAATA
9-IRR	AAAGATGGAAAATCTTTCAAACAATAATAATC......CACAAGAAAATA
56-IRR	AAAGATGGAAAATCTTTCAAACAATAATAATC......CACAAGAAAATA
cp9-IRb	AAAAATGAAAAACT.....TA.AACAATAATC......CACAAAAAATTA

	Outside end
1-IRL	TTCAA
3-IRL	TTCAA
4-IRL	TTCAA
5-IRL	TTCAA
6-IRL	TTCAA
7-IRL	TTCAA
8-IRL	TTCAA
9-IRL	TTCAA
56-IRL	TTCAA
cp9-IRa	ATCAA
1-IRR	TTCAA
3-IRR	TTCAA
4-IRR	TTCAA
6-IRR	TTCAA
7-IRR	TTCAA
8-IRR	TTCAA
9-IRR	TTCAA
56-IRR	TTCAA
cp9-IRb	ATCAA

Part VI

A few nucleotide positions in the B. burgdorferi B31 genome sequence were determined to have sequencing template clones of two types in the DNA library. These are likely to represent heterogeneity in the culture that was sequenced and are listed below. They are indicated in the GENBANK sequences with ambiguous nucleotide symbols.

Standard ambiguous nucleotide nomenclature is used in the GENBANK entries and below:

Part VII

An improved version of TIGR ASSEMBLER was required to uniquely assemble the highly similar cp32s and lp56, as well as the very similar lp5 and lp21 plasmids. Very similar regions of DNA with only single base pair differences needed to be differentiated. In order to do this, unique base pairs within these repetitive regions needed to be identified. The new TIGR ASSEMBLER does this by counting the number of occurrences of each 32 bp oligomer (32mer) in the random sequence reads. 32mers which are not unique to a single plasmid or region will be over-represented. In determining the assembly, TIGR ASSEMBLER gives more weight to overlapping sequence reads which contain the same relatively under-represented 32mers, while giving much less weight to over-represented 32mers. In regions where there were few or no unique base pairs, clone mate constraints guided the assembly process. Clone mates are sequence reads from opposite ends of the same DNA clone. By using the known orientation of the clone mates and approximate size of the clone, TIGR ASSEMBLER chooses sequence read overlaps which satisfy the clone mate constraints. A new feature of TIGR ASSEMBLER which was essential for assembling the long tandem 63 bp repeat in lp21 is tandem 32mer masking. By default, any 32mer which occurs more than once in a single sequence read is not used for sequence overlap determination. This allowed small differences in the tandem repeat unit to determine correct overlaps while ignoring the myriad of possible non unique overlaps. The last important new feature of TIGR ASSEMBLER is the ability to initialize the assembly process with a previous set of assemblies from TIGR ASSEMBLER. The new TIGR ASSEMBLER did not achieve the final assemblies of the cp32s/lp56 or lp21 on the first iteration. The assemblies were inspected and, when determined to be incorrect, an assembly or portion of an assembly was discarded. The remaining assemblies and portion of assemblies were used to jump start TIGR ASSEMBLER and the process was repeated with different parameters until unique, internally consistent assemblies were achieved. Internal consistency was judged from clone mate constraints and base pair differences between overlapping sequence reads. This process was carried out without using information from the restriction maps of the plasmids that are described in the text.

Because of the difficulties encountered in the sequence assembly process (due to the extensive similarities among the plasmids), it was necessary to confirm the accuracy of the assembly of the plasmid sequences in B31. Restriction maps of five of the cp32 plasmids and of cp26 from B31 have been previously described in Casjens et al. (1997b) and Tilly et al. (1997), respectively. We therefore screened the pUC plasmid library clones used in the sequencing project (Fraser et al., 1997) for ones that hybridized uniquely or nearly so to only one of the remaining B31 linear plasmids in Southern analysis of CHEF gels of intact and of restricted B31 MI DNA, and these were used to construct restriction site maps of the cognate plasmids according to the strategy described by Casjens et al. (1997b) The structures of cp9 and lp17 were not confirmed in this way, since (i) they assembled unambiguously even with the original, less stringent TIGR ASSEMBLER, and (ii) Barbour et al. (1996) previously reported the sequence of B31 lp17, and (iii) Dunn et al. (1994) previously reported the sequence of a cp9-like plasmid from a related isolate. Our sequence assemblies agree with those sequences. For example for lp56 all of the 23 mapped sites were correctly predicted within experimental error by the assembled sequence of lp56. 344 restriction enzyme cleavage sites were mapped on the 19 plasmids, and all are correctly predicted by the sequence. In addition, no sites were found in the sequence that were not in the plasmid DNAs and vice versa (six differences between predictions made by the sequence and the previously published cp32-1, cp32-3, cp32-4 and cp32-6 restriction maps were found by further experimentation to be mapping errors).

Assembly of the sequences of the cp32s and the closely related portion of lp56 were particularly difficult. Nonetheless, they are likely to be correct since all of their restriction maps are predicted perfectly by the nucleotide sequences, which were assembled without knowledge of the restriction maps. All eight previously mapped restriction sites (or lack thereof) that are diagnostic of a single cp32 are present in the assembled sequence on the correct cp32, and all of the 19 blocks of sequence that had been previously mapped to individual cp32s (Casjens et al., 1997; Stevenson et al., 1998b; Zuckert and Meyer, 1996) are present in the correct cp32 at the experimentally determined location. (We note that the pOMB25 sequence that was attributed without mapping data to cp32-1 (Zuckert and Meyer, 1996) is actually in the cp32-3 sequence.) Although we feel it is unlikely, it remains possible that small regions of similar sequences could be placed on the wrong cp32 by our assembly technique.

Assembly of the lp21 sequence had a special problem in that it contains a long tract of a 63 bp direct repeat. The lp21 sequence reported here contains 11,004 bp, or 176 (plus one partial) tandem copies of the repeat unit. There are no unique, unrelated sequences interspersed among the 63 bp repeats, and not all of the repeats are identical, as is indicated experimentally by the small number of Tsp509I sites within the tract. This non-identity made assembly from random sequencing runs possible. In the reported sequence there are 34 distinct repeat sequences; 27 of these types (128 total repeat units) are 63 bp long and 7 types (48 units) are 61 bp long. The maximum number of adjacent identical units is three, and there are two large exact repeats within the tract; units 2-19 are identical to units 129-146 and units 20-30 are identical to units 31-41. In order to experimentally characterize this repeat tract further, we used Southern analysis to measure the sizes of several restriction fragments that contain all the repeats. CHEF electrophoresis gels of B31 MI DNA cleaved with MseI, DraI, AseI, HindIII, EcoRI, StuI, BsrGI, XbaI and EcoO109I (all of which are predicted not to cleave within the repeat region) gave single DNA bands of 11, 13, 14, 13, 16, 17, 18, 16 and 18 kbp (all ±1 kb), respectively, that hybridize to a 63 bp repeat DNA probe. In addition, Tsp509I gave probe reactive fragments of about 3.0, 3.5 and 4.3 kbp. MseI and Tsp509I cleave at TTAA and AATT, respectively, and so are expected to cleave the 71.8% A+T Borrelia DNA to an average fragment size of 60-70 bp; indeed the fragments mentioned above are by far the largest fragments (as observed by ethidium bromide staining) in complete digests of B31 DNA made by these two enzymes. The three Tsp509I fragments from genomic B31 DNA were gel purified and used as probes in Southern analyses of electrophoresis gels of uncleaved and MseI digested B31 DNA. All were found t o hybridize only to lp21 DNA and to the 11 kbp MseI band (data not shown). We also confirmed predictions from the sequence that three other four bp-recognizing restriction enzymes, AluI, RsaI and Sau3AI, do not cut the repeat region, and that the six bp recognizing SspI cuts the entire repeat region into very small (<300 bp) fragments. Calculations from the locations of the cleavage sites for the above nine enzymes in the surrounding unique sequence gave a repeat tract length value of 11.9±1.0 kbp. This is in reasonable agreement with the 11 kbp in the sequence, as are the predicted sizes of the Tsp509I repeat-containing bands (2.9, 3.6 and 4.5 kbp; cf. measured sizes above), and we conclude that the assembly of this repeat region is likely to be accurate. Thus the sequences of all twenty-one of the plasmids are strongly supported either by physical maps that are correctly predicted by the sequence or by independent sequence determinations.

PART VIII

Akins, D. R., Caimano, M. J., Yang, X., Cerna, F., Norgard, M. V., and Radolf, J. D. (1999) Molecular and Evolutionary Analysis of Borrelia burgdorferi 297 Circular Plasmid-Encoded Lipoproteins with OspE- and OspF-Like Leader Peptides. Infect Immun 67: 1526-1532.

Akins, D. R., Popova, T., Brusca, J., Goldberg, M. L., Li, M., Baker, S. C., and Norgard, M. V. (1993) Use of PhoA Gene Fusions and Anchored PCR to Identify and Express Borrelia burgdorferi Candidate Outer Membrane Proteins. GENBANK ACCESSION #: L31427.

Akins, D. R., Popova, T., Brusca, J., Goldberg, M. L., Li, M., Baker, S. C., and Norgard, M. V. (1995a) Use of PhoA Gene Fusions and Anchored PCR to Identify and Express Borrelia burgdorferi Candidate Outer Membrane Proteins. GENBANK ACCESSION #: L31423.

Akins, D. R., Porcella, S., Norgard, M. V., and Radolf, J. D. (1994) Borrelia burgdorferi protein p23. GENBANK ACCESSION #: L31616.

Akins, D. R., Porcella, S. F., Popova, T. G., Shevchenko, D., Baker, S. I., Li, M., Norgard, M. V., and Radolf, J. D. (1995b) Evidence for in vivo but not in vitro expression of a Borrelia burgdorferi outer surface protein F (OspF) homologue. Mol Microbiol 18: 507-20.

Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25: 3389-402.

Amouriaux, P., Assous, M., Margarita, D., Baranton, G., and Saint Girons, I. (1993) Polymerase chain reaction with the 30-kb circular plasmid of Borrelia burgdorferi B31 as a target for detection of the Lyme borreliosis agents in cerebrospinal fluid. Res Microbiol 144: 211-9.

Balmelli, T., Valsangiacomo, C., Peter, O., and Piffaretti, J.-C. (1996) Borrelia garinii 70 kbp plasmid D6 protein gene. GENBANK ACCESSION #: U50840.

Bancroft, I., and Wolk, C. P. (1989) Characterization of an insertion sequence (IS891) of novel structure from the cyanobacterium Anabaena sp. strain M-131. J Bacteriol 171: 5949-54.

Barbour, A. G., and Carter, C. J. (1997) Putative transposase with translational frameshifting in the Lyme disease agent Borrelia burgdorderi. GENBANK ACCESSION #: U85588.

Barbour, A. G., Carter, C. J., Bundoc, V., and Hinnebusch, J. (1996) The nucleotide sequence of a linear plasmid of Borrelia burgdorferi reveals similarities to those of circular plasmids of other prokaryotes. J Bacteriol 178: 6635-9.

Barbour, A. G., Tessier, S. L., and Hayes, S. F. (1984) Variation in a major surface protein of Lyme disease spirochetes. Infect Immun 45: 94-100.

Barbour, A. G., Tessier, S. L., and Todd, W. J. (1983) Lyme disease spirochetes and ixodid tick spirochetes share a common surface antigenic determinant defined by a monoclonal antibody. Infect Immun 41: 795-804.

Bergstrom, S., Bundoc, V. G., and Barbour, A. G. (1989) Molecular analysis of linear plasmid-encoded major surface proteins, OspA and OspB, of the Lyme disease spirochaete Borrelia burgdorferi. Mol Microbiol 3: 479-86.

Bono, J. L., Tilly, K., Stevenson, B., Hogan, D., and Rosa, P. (1998) Oligopeptide permease in Borrelia burgdorferi: putative peptide-binding components encoded by both chromosomal and plasmid loci. Microbiology 144: 1033-44.

Brandt, M. E., Riley, B. S., Radolf, J. D., and Norgard, M. V. (1990) Immunogenic integral membrane proteins of Borrelia burgdorferi are lipoproteins. Infect Immun 58: 983-91.

Bunikis, J., Olsen, B., Fingerle, V., Bonnedahl, J., Wilske, B., and Bergstrom, S. (1996) Molecular polymorphism of the lyme disease agent Borrelia garinii in northern Europe is influenced by a novel enzootic Borrelia focus in the North Atlantic. J Clin Microbiol 34: 364-8.

Caporale, D. A., and Kocher, T. D. (1994) Sequence variation in the outer-surface-protein genes of Borrelia burgdorferi. Mol Biol Evol 11: 51-64.

Casjens, S., Delange, M., Ley, H. L., 3rd, Rosa, P., and Huang, W. M. (1995) Linear chromosomes of Lyme disease agent spirochetes: genetic diversity and conservation of gene order. J Bacteriol 177: 2769-80.

Casjens, S., Palmer, N., van Vugt, R., Huang, W. M., Stevenson, B., Rosa, P., Lathigra, R., Sutton, G., Peterson, J., Dodson, R., Haft, D., Hickey, E., Gwinn, M., White, O., and Fraser, C. (2000) A bacterial genome in flux: The twelve linear and nine circular extrachromosomal DNAs of an infectious isolate of the Lyme disease spirochete Borrelia burgdorferi. Molecular Microbiology 35: in press.

Casjens, S., van Vugt, R., Tilly, K., Rosa, P. A., and Stevenson, B. (1997) Homology throughout the multiple 32-kilobase circular plasmids present in Lyme disease spirochetes. J Bacteriol 179: 217-27.

Champion, C. I., Blanco, D. R., Skare, J. T., Haake, D. A., Giladi, M., Foley, D., Miller, J. N., and Lovett, M. A. (1994) A 9.0-kilobase-pair circular plasmid of Borrelia burgdorferi encodes an exported protein: evidence for expression only during infection. Infect Immun 62: 2653-61.

Donadio, S., and Staver, M. J. (1993) IS1136, an insertion element in the erythromycin gene cluster of Saccharopolyspora erythraea. Gene 126: 147-51.

Dunn, J. J., Buchstein, S. R., Butler, L. L., Fisenne, S., Polin, D. S., Lade, B. N., and Luft, B. J. (1994) Complete nucleotide sequence of a circular plasmid from the Lyme disease spirochete, Borrelia burgdorferi. J Bacteriol 176: 2706-17.

Feng, S., Das, S., Barthold, S. W., and Fikrig, E. (1996) Characterization of two genes, p11 and p5, on the Borrelia burgdorferi 49-kilo base linear plasmid. Biochim Biophys Acta 1307: 270-2.

Feng, S., Das, S., Lam, T., Flavell, R. A., and Fikrig, E. (1995) A 55-kilodalton antigen encoded by a gene on a Borrelia burgdorferi 49- kilobase plasmid is recognized by antibodies in sera from patients with Lyme disease. Infect Immun 63: 3459-66.

Fikrig, E., Barthold, S. W., Sun, W., Feng, W., Telford, S. R., 3rd, and Flavell, R. A. (1997) Borrelia burgdorferi P35 and P37 proteins, expressed in vivo, elicit protective immunity. Immunity 6: 531-9.

Fikrig, E., Chen, M., Barthold, S. W., Anguita, J., Feng, W., Telford, S. R., and Flavell, R. A. (1999) Borrelia burgdorferi erpT expression in the arthropod vectcor and murine host. Molecular Microbiology 21: 281-290.

Fraser, C. M., Casjens, S., Huang, W. M., Sutton, G. G., Clayton, R., Lathigra, R., White, O., Ketchum, K. A., Dodson, R., Hickey, E. K., Gwinn, M., Dougherty, B., Tomb, J. F., Fleischmann, R. D., Richardson, D., Peterson, J., Kerlavage, A. R., Quackenbush, J., Salzberg, S., Hanson, M., van Vugt, R., Palmer, N., Adams, M. D., Gocayne, J., Venter, J. C., and et al. (1997) Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi. Nature 390: 580-6.

Fuchs, R., Jauris, S., Lottspeich, F., Preac-Mursic, V., Wilske, B., and Soutschek, E. (1992) Molecular analysis and expression of a Borrelia burgdorferi gene encoding a 22 kDa protein (pC) in Escherichia coli. Mol Microbiol 6: 503-9.

Gilmore, R. D., Jr., Kappel, K. J., and Johnson, B. J. (1997) Molecular characterization of a 35-kilodalton protein of Borrelia burgdorferi, an antigen of diagnostic importance in early Lyme disease. J Clin Microbiol 35: 86-91.

Gilmore, R. D., Jr., and Mbow, M. L. (1998) A monoclonal antibody generated by antigen inoculation via tick bite is reactive to the Borrelia burgdorferi Rev protein, a member of the 2.9 gene family locus. Infect Immun 66: 980-6.

Guina, T., and Oliver, D. B. (1997) Cloning and analysis of a Borrelia burgdorferi membrane-interactive protein exhibiting haemolytic activity. Mol Microbiol 24: 1201-13.

Gulig, P. A., Caldwell, A. L., and Chiodo, V. A. (1992) Identification, genetic analysis and DNA sequence of a 7.8-kb virulence region of the Salmonella typhimurium virulence plasmid. Mol Microbiol 6: 1395-411.

Guo, B. P., Brown, E. L., Dorward, D. W., Rosenberg, L. C., and Hook, M. (1998) Decorin-binding adhesins from Borrelia burgdorferi. Molecular Microbiology 30: 711-23.

Hagman, K. E., Lahdenne, P., Popova, T. G., Porcella, S. F., Akins, D. R., Radolf, J. D., and Norgard, M. V. (1998) Decorin-binding protein of Borrelia burgdorferi is encoded within a two- gene operon and is protective in the murine model of Lyme borreliosis. Infect Immun 66: 2674-83.

Hanson, M. S., Cassatt, D. R., Guo, B. P., Patel, N. K., McCarthy, M. P., Dorward, D. W., and Hook, M. (1998) Active and passive immunity against Borrelia burgdorferi decorin binding protein A (DbpA) protects against infection. Infect Immun 66: 2143-53.

Hinnebusch, J., Bergstrom, S., and Barbour, A. G. (1990) Cloning and sequence analysis of linear plasmid telomeres of the bacterium Borrelia burgdorferi. Mol Microbiol 4: 811-20.

Indest, K. J., Ramamoorthy, R., Sole, M., Gilmore, R. D., Johnson, B. J., and Philipp, M. T. (1997) Cell-density-dependent expression of Borrelia burgdorferi lipoproteins in vitro. Infect Immun 65: 1165-71.

Jauris-Heipke, S., Fuchs, R., Motz, M., Preac-Mursic, V., Schwab, E., Soutschek, E., Will, G., and Wilske, B. (1993) Genetic heterogenity of the genes coding for the outer surface protein C (OspC) and the flagellin of Borrelia burgdorferi. Med Microbiol Immunol (Berl) 182: 37-50.

Jauris-Heipke, S., Liegl, G., Preac-Mursic, V., Rossler, D., Schwab, E., Soutschek, E., Will, G., and Wilske, B. (1995) Molecular analysis of genes encoding outer surface protein C (OspC) of Borrelia burgdorferi sensu lato: relationship to ospA genotype and evidence of lateral gene exchange of ospC. J Clin Microbiol 33: 1860-6.

Jonsson, M., Noppa, L., Barbour, A. G., and Bergstrom, S. (1992) Heterogeneity of outer membrane proteins in Borrelia burgdorferi: comparison of osp operons of three isolates of different geographic origins. Infect Immun 60: 1845-53.

Katona, L. I., Beck, G., and Habicht, G. S. (1992) Purification and immunological characterization of a major low- molecular-weight lipoprotein from Borrelia burgdorferi. Infect Immun 60: 4995-5003.

Krause, M., Harwood, J., Fierer, J., and Guiney, D. (1991) Genetic analysis of homology between the virulence plasmids of Salmonella dublin and Yersinia pseudotuberculosis. Infect Immun 59: 1860-3.

Lahdenne, P., Porcella, S. F., Hagman, K. E., Akins, D. R., Popova, T. G., Cox, D. L., Katona, L. I., Radolf, J. D., and Norgard, M. V. (1997) Molecular characterization of a 6.6-kilodalton Borrelia burgdorferi outer membrane-associated lipoprotein (lp6.6) which appears to be downregulated during mammalian infection. Infect Immun 65: 412-21.

Lam, T. T., Nguyen, T. P., Montgomery, R. R., Kantor, F. S., Fikrig, E., and Flavell, R. A. (1994) Outer surface proteins E and F of Borrelia burgdorferi, the agent of Lyme disease. Infect Immun 62: 290-8.

Li, H., Dunn, J. J., Luft, B. J., and Lawson, C. L. (1997) Crystal structure of Lyme disease antigen outer surface protein A complexed with an Fab. Proc Natl Acad Sci U S A 94: 3584-9.

Marconi, R. T., Casjens, S., Munderloh, U. G., and Samuels, D. S. (1996a) Analysis of linear plasmid dimers in Borrelia burgdorferi sensu lato isolates: implications concerning the potential mechanism of linear plasmid replication. J Bacteriol 178: 3357-61.

Marconi, R. T., Konkel, M. E., and Garon, C. F. (1993a) Variability of osp genes and gene products among species of Lyme disease spirochetes. Infect Immun 61: 2611-7.

Marconi, R. T., Samuels, D. S., and Garon, C. F. (1993b) Transcriptional analyses and mapping of the ospC gene in Lyme disease spirochetes. J Bacteriol 175: 926-32.

Marconi, R. T., Samuels, D. S., Landry, R. K., and Garon, C. F. (1994) Analysis of the distribution and molecular heterogeneity of the ospD gene among the Lyme disease spirochetes: evidence for lateral gene exchange. J Bacteriol 176: 4572-82.

Marconi, R. T., Samuels, D. S., Schwan, T. G., and Garon, C. F. (1993c) Identification of a protein in several Borrelia species which is related to OspC of the Lyme disease spirochetes. J Clin Microbiol 31: 2577-83.

Marconi, R. T., Sung, S. Y., Hughes, C. A., and Carlyon, J. A. (1996b) Molecular and evolutionary analyses of a variable series of genes in Borrelia burgdorferi that are related to ospE and ospF, constitute a gene family, and share a common upstream homology box. J Bacteriol 178: 5615-26.

Margolis, N., Hogan, D., Cieplak, W., Jr., Schwan, T. G., and Rosa, P. A. (1994a) Homology between Borrelia burgdorferi OspC and members of the family of Borrelia hermsii variable major proteins. Gene 143: 105-10.

Margolis, N., Hogan, D., Tilly, K., and Rosa, P. A. (1994b) Plasmid location of Borrelia purine biosynthesis gene homologs. J Bacteriol 176: 6427-32.

Masuzawa, T., Komikado, T., and Yanagihara, Y. (1997) PCR-restriction fragment length polymorphism analysis of the ospC gene for detection of mixed culture and for epidemiological typing of Borrelia burgdorferi sensu stricto. Clin Diagn Lab Immunol 4: 60-3.

Mathiesen, D. A., Oliver, J. H., Jr., Kolbert, C. P., Tullson, E. D., Johnson, B. J., Campbell, G. L., Mitchell, P. D., Reed, K. D., Telford, S. R., 3rd, Anderson, J. F., Lane, R. S., and Persing, D. H. (1997) Genetic heterogeneity of Borrelia burgdorferi in the United States. J Infect Dis 175: 98-107.

McGrath, B. C., Dunn, J. J., Buchstein, S. R., and Luft, B. J. (1997) Adaptation of RARE cleavage for mapping genes in Borrelia burgdorferi. GENBANK ACCESSION #: U22451.

McGrath, B. C., Dunn, J. J., Gorgone, G., Guttman, D., Dykhuizen, D., and Luft, B. J. (1995) Identification of an immunologically important hypervariable domain of major outer surface protein A of Borrelia burgdorferi [published erratum appears in Infect Immun 1995 Jun;63(6):2390]. Infect Immun 63: 1356-61.

Murai, N., Kamata, H., Nagashima, Y., Yagisawa, H., and Hirata, H. (1995) A novel insertion sequence (IS)-like element of the thermophilic bacterium PS3 promotes expression of the alanine carrier protein- encoding gene. Gene 163: 103-7.

Nevill-Manning, C. G., Wu, T. D., and Brutlag, D. L. (1998) Highly specific protein sequence motifs for genome analysis. Proc Natl Acad Sci U S A 95: 5865-71.

Norris, S. J., Carter, C. J., Howell, J. K., and Barbour, A. G. (1992) Low-passage-associated proteins of Borrelia burgdorferi B31: characterization and molecular cloning of OspD, a surface-exposed, plasmid-encoded lipoprotein. Infect Immun 60: 4662-72.

Porcella, S. F., Popova, T. G., Akins, D. R., Li, M., Radolf, J. D., and Norgard, M. V. (1996) Borrelia burgdorferi supercoiled plasmids encode multicopy tandem open reading frames and a lipoprotein gene family. J Bacteriol 178: 3293-307.

Probert, W., and Johnson, B. (1998) Identification of a 47 kd fibronectin-binding protein expressed by Borrelia burgdorferi isolate B31. Molecular Microbiology 30: 1003-1015.

Reindl, M., Redl, B., and Stoffler, G. (1993) Isolation and analysis of a linear plasmid-located gene of Borrelia burgdorferi B29 encoding a 27 kDa surface lipoprotein (P27) and its overexpression in Escherichia coli. Mol Microbiol 8: 1115-24.

Rosa, P. A., Schwan, T., and Hogan, D. (1992) Recombination between genes encoding major outer surface proteins A and B of Borrelia burgdorferi. Mol Microbiol 6: 3031-40.

Samuels, D. S., Marconi, R. T., and Garon, C. F. (1993) Variation in the size of the ospA-containing linear plasmid, but not the linear chromosome, among the three Borrelia species associated with Lyme disease. J Gen Microbiol 139: 2445-9.

Schwan, T. G., Piesman, J., Golde, W. T., Dolan, M. C., and Rosa, P. A. (1995) Induction of an outer surface protein on Borrelia burgdorferi during tick feeding. Proc Natl Acad Sci U S A 92: 2909-13.

Skare, J. T., Champion, C. I., Mirzabekov, T. A., Shang, E. S., Blanco, D. R., Erdjument-Bromage, H., Tempst, P., Kagan, B. L., Miller, J. N., and Lovett, M. A. (1996) Porin activity of the native and recombinant outer membrane protein Oms28 of Borrelia burgdorferi. J Bacteriol 178: 4909-18.

Stevenson, B., and Barthold, S. W. (1994) Expression and sequence of outer surface protein C among North American isolates of Borrelia burgdorferi. FEMS Microbiol Lett 124: 367-72.

Stevenson, B., Bockenstedt, L. K., and Barthold, S. W. (1994) Expression and gene sequence of outer surface protein C of Borrelia burgdorferi reisolated from chronically infected mice. Infect Immun 62: 3568-71.

Stevenson, B., Bono, J. L., Schwan, T. G., and Rosa, P. (1998a) Borrelia burgdorferi erp proteins are immunogenic in mammals infected by tick bite, and their synthesis is inducible in cultured bacteria. Infect Immun 66: 2648-54.

Stevenson, B., Casjens, S., and Rosa, P. (1998b) Evidence of past recombination events among the genes encoding the Erp antigens of Borrelia burgdorferi. Microbiology 144: 1869-79.

Stevenson, B., Casjens, S., van Vugt, R., Porcella, S. F., Tilly, K., Bono, J. L., and Rosa, P. (1997) Characterization of cp18, a naturally truncated member of the cp32 family of Borrelia burgdorferi plasmids. J Bacteriol 179: 4285-91.

Stevenson, B., Schwan, T. G., and Rosa, P. A. (1995) Temperature-related differential expression of antigens in the Lyme disease spirochete, Borrelia burgdorferi. Infect Immun 63: 4535-9.

Stevenson, B., Tilly, K., and Rosa, P. A. (1996) A family of genes located on four separate 32-kilobase circular plasmids in Borrelia burgdorferi B31. J Bacteriol 178: 3508-16.

Suk, K., Das, S., Sun, W., Jwang, B., Barthold, S. W., Flavell, R. A., and Fikrig, E. (1995) Borrelia burgdorferi genes selectively expressed in the infected host. Proc Natl Acad Sci U S A 92: 4269-73.

Sutcliffe, I., and Russell, R. (1995) Lipoproteins of Gram-positive bacteria. J. Bacteriol. 177: 1123-1128.

Theisen, M. (1996) Molecular cloning and characterization of nlpH, encoding a novel, surface-exposed, polymorphic, plasmid-encoded 33-kilodalton lipoprotein of Borrelia afzelii. J Bacteriol 178: 6435-42.

Tilly, K., Casjens, S., Stevenson, B., Bono, J. L., Samuels, D. S., Hogan, D., and Rosa, P. (1997) The Borrelia burgdorferi circular plasmid cp26: conservation of plasmid structure and targeted inactivation of the ospC gene. Mol Microbiol 25: 361-73.

Wallich, R., Brenner, C., Kramer, M. D., and Simon, M. M. (1995) Molecular cloning and immunological characterization of a novel linear- plasmid-encoded gene, pG, of Borrelia burgdorferi expressed only in vivo. Infect Immun 63: 3327-35.

Wallich, R., Helmes, C., Schaible, U. E., Lobet, Y., Moter, S. E., Kramer, M. D., and Simon, M. M. (1992) Evaluation of genetic divergence among Borrelia burgdorferi isolates by use of OspA, fla, HSP60, and HSP70 gene probes. Infect Immun 60: 4856-66.

Wallich, R., Schaible, U. E., Simon, M. M., Heiberger, A., and Kramer, M. D. (1989) Cloning and sequencing of the gene encoding the outer surface protein A (OspA) of a European Borrelia burgdorferi isolate. Nucleic Acids Res 17: 8864.

Wang, I., Dykhuizen, D., Qiu, W., Dunn, J., Bosler, E., and Luft, B. (1999) Genetic diversity of ospC in a local population of Borrelia burgdorferi sensu stricto. Genetics 151: 15-30.

Wang, J., Masuzawa, T., Komikado, T., and Yanagihara, Y. (1997a) Consensus sequence on the genes encoding the major outer surface proteins (OspA and OspB) of Borrelia garinii isolate. Microbiol Immunol 41: 83-91.

Wang, J., Masuzawa, T., Li, M., and Yanagihara, Y. (1997b) Deletion in the genes encoding outer surface proteins OspA and OspB of Borrelia garinii isolated from patients in Japan. Microbiol Immunol 41: 673-9.

Wang, J., Masuzawa, T., Li, M., and Yanagihara, Y. (1997c) An unusual illegitimate recombination occurs in the linear-plasmid- encoded outer-surface protein A gene of Borrelia afzelii. Microbiology 143: 3819-25.

Will, G., Jauris-Heipke, S., Schwab, E., Busch, U., Rossler, D., Soutschek, E., Wilske, B., and Preac-Mursic, V. (1995) Sequence analysis of ospA genes shows homogeneity within Borrelia burgdorferi sensu stricto and Borrelia afzelii strains but reveals major subgroups within the Borrelia garinii species. Med Microbiol Immunol (Berl) 184: 73-80.

Wilske, B., Busch, U., Eiffert, H., Fingerle, V., Pfister, H. W., Rossler, D., and Preac-Mursic, V. (1996a) Diversity of OspA and OspC among cerebrospinal fluid isolates of Borrelia burgdorferi sensu lato from patients with neuroborreliosis in Germany. Med Microbiol Immunol (Berl) 184: 195-201.

Wilske, B., Busch, U., Fingerle, V., Jauris-Heipke, S., Preac Mursic, V., Rossler, D., and Will, G. (1996b) Immunological and molecular variability of OspA and OspC. Implications for Borrelia vaccine development. Infection 24: 208-12.

Wilske, B., Luft, B., Schubach, W. H., Zumstein, G., Jauris, S., Preac-Mursic, V., and Kramer, M. D. (1992) Molecular analysis of the outer surface protein A (OspA) of Borrelia burgdorferi for conserved and variable antibody binding domains. Med Microbiol Immunol 181: 191-207.

Wilske, B., Preac-Mursic, V., Jauris, S., Hofmann, A., Pradel, I., Soutschek, E., Schwab, E., Will, G., and Wanner, G. (1993) Immunological and molecular polymorphisms of OspC, an immunodominant major outer surface protein of Borrelia burgdorferi. Infect Immun 61: 2182-91.

Zhang, J. R., Hardham, J. M., Barbour, A. G., and Norris, S. J. (1997) Antigenic variation in Lyme disease borreliae by promiscuous recombination of VMP-like sequence cassettes. Cell 89: 275-85.

Zhang, J. R., and Norris, S. J. (1998a) Genetic variation of the Borrelia burgdorferi gene vlsE involves cassette-specific, segmental gene conversion. Infect Immun 66: 3698-704.

Zhang, J. R., and Norris, S. J. (1998b) Kinetics and in vivo induction of genetic variation of vlsE in Borrelia burgdorferi. Infect Immun 66: 3689-97.

Zhou, X., Cahoon, M., Rosa, P., and Hedstrom, L. (1997) Expression, purification, and characterization of inosine 5’- monophosphate dehydrogenase from Borrelia burgdorferi. J Biol Chem 272: 21977-81.

Zuckert, W. R., and Meyer, J. (1996) Circular and linear plasmids of Lyme disease spirochetes have extensive homology: characterization of a repeated DNA element. J Bacteriol 178: 2287-98.

Zuckert, W., Meyer, J. and Barbour, A. (1999) Circular and linear plasmids of Lyme disease spirochetes have extensive homology: characterization of a repeated DNA element. Infect. Immun. 67: 3257-66.

Zumstein, G., Fuchs, R., Hofmann, A., Preac-Mursic, V., Soutschek, E., and Wilske, B. (1992) Genetic polymorphism of the gene encoding the outer surface protein A (OspA) of Borrelia burgdorferi. Med Microbiol Immunol 181: 57-70.

	Introduction and Summary
Part I	Annotated Complete B31 Plasmid Gene/Pseudogene List
Part II	B31 Paralogous Gene Families
Part III	Putative B31 Plasmid Lipoprotein Genes
Part IV	The Pseudo-, Questionable, and Short Genes on the B31 Plasmids
Part V	Short Sequence Repeats in the B31 Plasmids
Part VI	*Ambiguous Nucleotides in the B. burgdorferi* B31 Genome Sequence**
Part VII	Genome Sequence Assembly Methods
Part VIII	References

Annotated Borrelia burgdorferi B31 Plasmid Nucleotide Sequences

Fraser et al. (1997) and Casjens et al. (2000)

Table of Contents

ORGANIZATION OF THIS DOCUMENT (read me first)

B31 Plasmid Open Reading Frame Summary

Part I

Part II

Part III

Part IV

Part V

Part VI

Part VII

PART VIII