Back

stj fimbrial operon has a role on S. typhimurium pathogenicity

Abstract number: P1303

Avsaroglu M.D., Akkoc N., Akcelik M.

Objectives: To exhibit the role of stj fimbrial operon on the patogenicity of S. Typhimurium by animal experiments using mice model system.

Methods: The left and the right-end fragments of stjA gene were amplified with following primers; left-end F primer having BglII cutting site: GCAGATCTGCGGAAGTGATTTCACCGG/B primer having SalI cutting site CGGTCGACCCAAATGACATGTAATGCGCGGGTCGGG; right-end F primer having SalI cutting site: CGGTCGACCTCCAGCATTCACATGGAATATTCAACACC/B primer having XbaI cutting site GCTCTAGATCCAGTTTCACACCATTGTCGGTC. Amplified fragments were than cloned to pGB704 vector plasmid. A kanamisin gene cassette was inserted between the two fragments on the vector plasmid. The recombinant plasmid was transformed to the S. Typhimurium IR 715 strain by conjugation. By the aid of left and the right-end fragments of stjA gene on the vector plasmid homolog recombination was occurred with the stjA gene on the chromosome of the host and the gene was knocked-out with kanamisin gene cassette. Animal experiments were performed with the mutant and wild type strain of S. Typhimurium.

Results: The experiments based on the competition between the wild type strain and degenerate mutant strain of stj operon. To construct the knocked-out mutant strain, one of the five genes in the operon, stjA, was degenerated with the kanamisin gene cassette on the plasmid pGP704. The mutants were named S. Typhimurium MA44 and used in animal experiment as knocked-out mutant strain of stjA gene. In the animal experiments, mice model system was used. AJB715 (S. Typhimurium lack of acid phosphotase activity) was used as the stjA wild type strain. 6–8 week female mice were inoculated orally with MA44 and AJB715. Viable cells in faeces and organ samples were counted and analysed statistically. It was observed that there was a significant (p < 0.05) reduction in the number of MA44 mutant strain in comparison to AJB715 wild type strain.

Conclusions: The results exhibited that stj operon plays an important role in the pathogenicity of S. Typhimurium by effecting the reproduction and stability functions of host organism in the target tissue systems.

Acknowledgements: This work was supported by the Scientific and Technological Research Council of Turkey (TUBITAK) grant 107T459.

Session Details

Date: 19/04/2008
Time: 00:00-00:00
Session name: 18th European Congress of Clinical Microbiology and Infectious Diseases
Subject:
Location: Barcelona, Spain
Presentation type:
Back to top