Back

Detection of HIV sequences in respiratory tract bacteria of Cambodia and Kenya AIDS-positive patients

Abstract number: r2167

Zajac  V., Kovac  M., Ciernikova  S., Mego  M., Stevurkova  V., Liskova  A., Krcmery  V.

Objectives: 

The hypothesis whether bacteria from respiratory tract of HIV-1 positive patients carry HIV-like sequences was examined.

Material and methods: 

Bacteria and Patients. Respiratory tract (nose, pharyngeal svabs) bacteria were isolated from 38 Cambodian and 24 Kenyan HIV-1 positive patients.

PCR amplification. Polymerase chain reaction specific for HIV sequences was carried out using these primers:

P38F: ATAATCCACCTATCCCAGTAGGAGAAT

P39R: TTTGGTCCTTGTCTTATGTCCAGAATG

P1F: CATTTGGAAAGGACCAGCAAAACTACT

E1R: TCATATGCTTTAGCATCTGATGCACAA

E68F: AGCAGCAGGAAGCACTATGG

E69R: CCAGACTGTGAGTTGCAACAG

G3F: TTGGACATAAGACAAGGGCCAAAA

G4R: GTCGTTGCCAAAGAGTGATTTGAG

Hybridization. 32P-labeled probes used were following: 38-39; 68-69, P1-E1 and G3-G4. DNA sequencing. The sequencing reaction was performed using Big Dye Terminator kit and sequences were resolved on 310 Genetic Analyzer.

Results: 

Bacteria were diluted to concentration 10-10 and single colonies were analysed. Around 34% of bacteria isolated from Cambodian and 33% from Kenyan AIDS patients were found to be positive in colony hybridization with HIV-specific PCR probes prepared using mentioned primers on pHB10 template. Bacterial DNA of all patients was isolated and 200–300 ng were analysed in dot blot using the same HIV specific probes. Approximately 31% of DNA isolated from Cambodian and 31.5% of Kenyan HIV-positive patients were positive in dot blot assay. Reproducibility of results between dot blot and colony hybridization was more than 90%. Bacterial DNA of positive isolates was amplified in PCR reaction with all four sets of primers. Sequencing of these products revealed high homology with the reference HIV sequence, while these sequences were not present in samples isolated from healthy individuals. Bacteria bearing HIV-like sequences were classified as Klebsiella pneumoniae (48%), Staphylococcus aureus (13%), Staphylococcuspyogenes (9%), Escherichia coli (4%), Proteus mirabilis (4%) and Candida albicans (17%), Candida tropicalis (9%) respectively.

Conclusions: 

1. HIV-1 sequences were detected in respiratory tract bacteria of Cambodian (34%) and Kenyan (33%) AIDS patients by colony and dot blot hybridization (31; 31.5%) using HIV-1 specific probes.

2. PCR amplification and subsequent sequencing of positive bacterial DNA samples revealed high homology with HIV-1.

Session Details

Date: 01/08/2007
Time: 00:00-00:00
Session name: XXIst ISTH Congress
Subject:
Location: Oxford, UK
Presentation type:
Back to top